ID: 1006874036

View in Genome Browser
Species Human (GRCh38)
Location 6:37279879-37279901
Sequence AAGTTGTGGACTCCACCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006874036_1006874040 8 Left 1006874036 6:37279879-37279901 CCCTGTGGTGGAGTCCACAACTT 0: 1
1: 0
2: 2
3: 6
4: 70
Right 1006874040 6:37279910-37279932 TGATTGCTTCACATTGCTTTAGG 0: 1
1: 0
2: 1
3: 27
4: 297
1006874036_1006874042 18 Left 1006874036 6:37279879-37279901 CCCTGTGGTGGAGTCCACAACTT 0: 1
1: 0
2: 2
3: 6
4: 70
Right 1006874042 6:37279920-37279942 ACATTGCTTTAGGCCTGGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 122
1006874036_1006874041 13 Left 1006874036 6:37279879-37279901 CCCTGTGGTGGAGTCCACAACTT 0: 1
1: 0
2: 2
3: 6
4: 70
Right 1006874041 6:37279915-37279937 GCTTCACATTGCTTTAGGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006874036 Original CRISPR AAGTTGTGGACTCCACCACA GGG (reversed) Intronic
900163286 1:1234660-1234682 GAGTTGTGGACTCGAGCCCAGGG + Exonic
901550249 1:9990637-9990659 ATGGTGTGGAGTCCACCACAAGG + Intergenic
909716419 1:78712903-78712925 AAGATGTGCAGTCCATCACAGGG + Intergenic
913690120 1:121271571-121271593 AAGCTGTGGAATAAACCACATGG - Intronic
914147420 1:145008392-145008414 AAGCTGTGGAATAAACCACATGG + Intronic
915954765 1:160212618-160212640 AAGGTATGGACACCACCAGAAGG - Intronic
916346948 1:163803431-163803453 AACATGTGGAATCCAGCACATGG + Intergenic
920477442 1:206290052-206290074 AAGCTGTGGAATAAACCACATGG - Intronic
920544393 1:206803320-206803342 AAGATGGGGACTCCTACACAGGG - Intronic
1063648407 10:7908914-7908936 AAGTTCTGGGCTCCATCCCAGGG - Intronic
1066200518 10:33139479-33139501 AAGATGTGGGCTCCAAAACACGG - Intergenic
1074912850 10:117927454-117927476 AAGCTGTGGGTTCCACCATAGGG + Intergenic
1076406410 10:130215111-130215133 AAGGTGGGGACTCCAACTCAGGG + Intergenic
1080162645 11:29196697-29196719 AAGTTGTGGACTTGAACAGATGG + Intergenic
1082092716 11:48102911-48102933 AAATCCTGGACTCCTCCACAGGG - Intronic
1084745912 11:71169075-71169097 CAGTTTTGGGCTCCACCACAGGG + Intronic
1086235374 11:84624089-84624111 AAGTTGAAGAATCCAACACATGG - Intronic
1088924375 11:114285434-114285456 AGGTTGTGGACTCCAAGAAAGGG + Intronic
1090114705 11:123956214-123956236 AACTTGCAGACTCCACCAAAAGG + Intergenic
1096548918 12:52359578-52359600 CAGTCATGGACTCCACCCCAAGG - Intergenic
1101294216 12:103403928-103403950 AAGTTGTGGATGGCACAACAGGG + Intronic
1102068543 12:109999167-109999189 CAGTTGTGGACCGAACCACATGG + Intronic
1106778147 13:33028087-33028109 AAGATGTGGACTCCGCCAATGGG - Intronic
1108421987 13:50260217-50260239 ATGTTGTGCACTCTAACACAGGG + Intronic
1111560852 13:89944658-89944680 AAGTTGTGAATTCTATCACATGG - Intergenic
1113661133 13:112106999-112107021 AAGTTGCGGAATGCACCAGAAGG - Intergenic
1120636075 14:86952595-86952617 AACTTGTGACCTCCACCTCAAGG - Intergenic
1121363545 14:93285974-93285996 AGGATGGGGACTCCACAACATGG + Intronic
1122525278 14:102378140-102378162 GAGTTGTGGCTTCCACCACATGG + Intronic
1122819207 14:104332831-104332853 AGGATGTGGAGTCCTCCACAGGG - Intergenic
1124060421 15:26288935-26288957 AAGTGGTGCAATCCAGCACATGG + Intergenic
1125431027 15:39593592-39593614 AAGTTGTAAACTCCACCACAGGG + Exonic
1130923681 15:88369314-88369336 AACCTGTGGACTCCAGGACACGG - Intergenic
1139898832 16:70310691-70310713 AAGTCTTGGACCCCAGCACAGGG - Intronic
1145899497 17:28480994-28481016 AAGTTGGGGACTCTACGCCAGGG - Intronic
1146140189 17:30360713-30360735 AAGTTGTGGATGCCTCCAAAAGG - Intergenic
1150491693 17:65578709-65578731 GAAGTGTGGACTCCACCACCAGG + Intronic
1150513136 17:65777240-65777262 AAGTTGAGGACTGCACCACAGGG + Intronic
1155882491 18:31166954-31166976 AAGTGGTGGACCTGACCACATGG + Intergenic
1158312489 18:56173233-56173255 AAGCTGTCAACTCCACCATAGGG + Intergenic
1161886964 19:7004585-7004607 AAGCTGTGACCTCCACAACAGGG - Intergenic
1162262501 19:9544255-9544277 AAGTGGTGGCAGCCACCACATGG - Intergenic
1168286321 19:55336189-55336211 AACTCATGGATTCCACCACAGGG + Intergenic
927618391 2:24623976-24623998 ATGTTGTGGACTCCATGAAAAGG - Intronic
931772926 2:65514640-65514662 AAATTGTGGACTCATCCAAAAGG - Intergenic
937175267 2:119924997-119925019 AGTTTGTGGACTCCAGCCCAGGG - Intronic
940117471 2:150224735-150224757 AAGTTGTTAACCACACCACATGG - Intergenic
941546992 2:166863403-166863425 AATTTGTGGAATCGAACACATGG + Intergenic
943277786 2:185890290-185890312 AACTTGTAGACTCAATCACAAGG + Intergenic
1169765322 20:9142174-9142196 ATGTTGTGGTCAGCACCACAAGG + Intronic
1183713064 22:39517876-39517898 AAGTTGTGGACTTGGCCTCAGGG - Exonic
956189879 3:66598435-66598457 AAGGTTTGGATTCCACCAAATGG + Intergenic
957158138 3:76572692-76572714 AAGTTGTGGAGTCCTCCTGAAGG - Intronic
961537455 3:127578788-127578810 AAGTTCTGGGCTAGACCACAAGG + Intronic
970488964 4:16552938-16552960 AAGTCAGTGACTCCACCACAGGG + Intronic
971496367 4:27270073-27270095 AAGTTGTGGGCTACACCATGTGG + Intergenic
972679644 4:41293163-41293185 AATGTGTGGGTTCCACCACAGGG + Intergenic
973919700 4:55672917-55672939 CAGTTGTGGCCACCACCACTGGG + Intergenic
978390502 4:108220212-108220234 TAGTGGTAGAATCCACCACATGG - Intergenic
987276376 5:16367375-16367397 AAGGTCAGGAGTCCACCACAGGG - Intergenic
990061192 5:51651035-51651057 AAGTTGTGGACTCAATCAAAGGG + Intergenic
994166432 5:96614179-96614201 AAGGTGAGAACTCCACCAGATGG + Intronic
996461161 5:123744624-123744646 AACTTGTGGACTCCAACTTATGG - Intergenic
1000311695 5:160051275-160051297 AAGTTTCGGACTCTACCACAAGG + Intronic
1003320147 6:5044000-5044022 AAGGTGTGCACCACACCACAGGG - Intergenic
1003968967 6:11280303-11280325 AGGTTGTTCACTCCACCACTTGG + Intronic
1006874036 6:37279879-37279901 AAGTTGTGGACTCCACCACAGGG - Intronic
1019055767 6:169222251-169222273 AGGTGGTGAACTCCACCACGGGG - Exonic
1023484560 7:40671378-40671400 AAGTTCTAGCCTCCACAACAAGG + Intronic
1023529287 7:41136478-41136500 TGGCTGTGGACTCCACCACCCGG + Intergenic
1034059367 7:148072345-148072367 AAGTTGTGACCGACACCACATGG - Intronic
1048991418 8:139762467-139762489 AAGCAATGGGCTCCACCACACGG - Intronic
1049176285 8:141194528-141194550 AAGTTCTGGAATCCACAACCAGG + Exonic
1062183291 9:135202649-135202671 AGGCAGTGGTCTCCACCACATGG + Intergenic
1200702950 Y:6417683-6417705 AATTTCTGGGCTCCATCACAAGG - Intergenic
1201031160 Y:9747014-9747036 AATTTCTGGGCTCCATCACAAGG + Intergenic
1201743595 Y:17348186-17348208 AAGTTGTAGGGTCCTCCACAGGG + Intergenic
1202130019 Y:21601032-21601054 AATGTGTGGACTCCAGCACAAGG - Intergenic
1202149212 Y:21829543-21829565 ATTGTGTGGACTCCAGCACAAGG + Intergenic