ID: 1006875861

View in Genome Browser
Species Human (GRCh38)
Location 6:37295646-37295668
Sequence AGGTTCTTACAGATCAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006875861 Original CRISPR AGGTTCTTACAGATCAAATA AGG Intronic
900704923 1:4074477-4074499 AGGTTCTTGCAAATTAAAAATGG - Intergenic
902036313 1:13460790-13460812 AGGTTCTTTCAGGTGAAACAGGG - Intergenic
902363605 1:15956345-15956367 AAGTGGTTACAGATCAAGTAGGG + Intronic
905582308 1:39091381-39091403 AGTTTCTTACAGTTAAAATGGGG + Intronic
905788381 1:40776101-40776123 AGTTTCTTACTTATAAAATAGGG - Intergenic
911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG + Intronic
913047095 1:115083643-115083665 ACGTGCGTACAGATCACATAGGG - Intronic
914502704 1:148261522-148261544 AGGTTTTTAAAGGTCAAAAAGGG - Intergenic
914952149 1:152125517-152125539 AGGTTCTGAGAACTCAAATATGG + Intergenic
915138082 1:153748012-153748034 AGGTTCATACACATCAAAACAGG - Intronic
919288481 1:195598161-195598183 AGTAGCTTACAGATCAAATCAGG + Intergenic
922921543 1:229309462-229309484 AAGTTCTCACAGCTCAGATAGGG - Intergenic
924621009 1:245660697-245660719 AGGTGCTTACAGAACAAGAAGGG - Intronic
1063085910 10:2817631-2817653 AGGTCTTTACAGAGAAAATAAGG - Intergenic
1063810017 10:9694034-9694056 AGGTTCTTCCTGACAAAATATGG - Intergenic
1066029352 10:31402849-31402871 AGCTTCTTGCAGATCAAAATTGG + Intronic
1069470663 10:68686594-68686616 AGGTTCTTGCACATAAGATAAGG + Exonic
1072702836 10:97656486-97656508 AGGTGCCTACAACTCAAATATGG + Intronic
1073278849 10:102336794-102336816 AGGATATTACAGCTAAAATAGGG - Intronic
1074535740 10:114327740-114327762 AGGATGTTACAGATCAGATTTGG + Intronic
1075621754 10:123933408-123933430 TGATTCTTAAAGTTCAAATATGG - Intronic
1078738487 11:14043939-14043961 AGGTTCTTACAAGTCAAATAAGG + Intronic
1079013023 11:16845279-16845301 AGGGCCTTGCAGATCATATAGGG + Intronic
1079962985 11:26946792-26946814 AGGATATTACAAATGAAATAAGG + Intergenic
1080269208 11:30433159-30433181 AGATTGTTACAGATCAGAAAGGG + Intronic
1080867178 11:36205573-36205595 AAGTCTTTACAGATCAAAAAAGG + Intronic
1083371717 11:62187670-62187692 AGGTTCTTACAGATGACAGATGG - Intergenic
1085868948 11:80326772-80326794 AGGTTGTTAAAGATGATATATGG - Intergenic
1087909564 11:103737547-103737569 AGGTTCTTACAGAGATAACATGG + Intergenic
1090599122 11:128351751-128351773 AGTTTCTTTCAAATCTAATAAGG - Intergenic
1092956936 12:13559977-13559999 AGGTACTGACAGAGGAAATATGG + Exonic
1093322270 12:17726806-17726828 AGGTGCTTTCAGAGAAAATATGG + Intergenic
1093331381 12:17846547-17846569 AGTTTCTTACAGACAACATATGG + Intergenic
1093997616 12:25658808-25658830 AGTTTCTTACAGAGAAAAGAAGG - Intergenic
1096502167 12:52070636-52070658 AGGTTTTCACAGACCAAATGTGG + Intronic
1100011010 12:89952974-89952996 GGGATCTGACAGAGCAAATAAGG + Intergenic
1100495893 12:95124330-95124352 AGGGTGGTACAGACCAAATATGG - Intronic
1101197162 12:102395511-102395533 AGGTTCACACGTATCAAATAAGG - Intergenic
1102405125 12:112666707-112666729 AGGTTCTTAGAGGTAAAATGGGG + Intronic
1105698332 13:22912956-22912978 AGGTTCTAACTCATGAAATAAGG + Intergenic
1106431929 13:29688977-29688999 AGGTTCTTACAGGTGACAGAGGG + Intergenic
1106475377 13:30093847-30093869 AGGGTCTTCCAGATGAGATAGGG - Intergenic
1107481022 13:40786431-40786453 AGTTTCTTATAGAACAAATTGGG + Intergenic
1110389472 13:74957406-74957428 TGCTTCTAACAAATCAAATATGG + Intergenic
1110820173 13:79906645-79906667 AGTTTCTTATAGATGAAACATGG - Intergenic
1113036973 13:106061614-106061636 AGGTCCTTACAGAACAAGCAAGG - Intergenic
1114446140 14:22789739-22789761 AAGTTCTTAAAGATGAAAGAGGG + Intronic
1116995278 14:51317260-51317282 AGTTTCTTATAGTTCAAATATGG + Intergenic
1117048816 14:51840262-51840284 AGCTTCTTAATGATAAAATAAGG - Intronic
1117532789 14:56675578-56675600 AGGTTCCTACAGATGGTATATGG - Intronic
1122255006 14:100470172-100470194 AGGTTCTTGCAGATGGAACAAGG + Intronic
1124158149 15:27246186-27246208 AGGTTCCTGGAGATCGAATATGG - Intronic
1135235155 16:20748212-20748234 AGGTTCTTTCAGTACAAATAAGG + Intronic
1135428179 16:22357814-22357836 AGGTTTTTATATATCAAACAAGG - Intronic
1135869989 16:26140781-26140803 AGGTTCTTTCAGATATAACAAGG + Intergenic
1139661850 16:68426299-68426321 GGGTTGTCAAAGATCAAATAAGG - Intronic
1141287173 16:82683252-82683274 AGGTTCCTGCAGATCAAACCTGG - Intronic
1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG + Intergenic
1146044081 17:29487670-29487692 AGGTTTCTACTGTTCAAATATGG + Intronic
1150624516 17:66833226-66833248 AGGGTCACACAGATCAAAAAGGG + Intergenic
1151030408 17:70731160-70731182 AGTTTCTTACAGTGCAAAAACGG + Intergenic
1153672256 18:7423009-7423031 CTGTTCTTTCAGATAAAATATGG - Intergenic
1156905215 18:42344503-42344525 AGCTTCTTAGAAATTAAATAAGG + Intergenic
1157024676 18:43828684-43828706 AAGTGCTTACAGCTCAAATGAGG + Intergenic
1157375207 18:47157445-47157467 CGGTTCTTACAGATCGAATAAGG + Exonic
1158353425 18:56589266-56589288 AGGCTCTCACAGAACAAATCTGG + Intergenic
1159638628 18:70837059-70837081 AGGTAATTTCAAATCAAATATGG - Intergenic
1161996600 19:7716557-7716579 AGGTACTTACAGACCTATTAGGG + Intergenic
929005519 2:37389523-37389545 AGGTTCTTAGAGAACACAAAAGG - Intergenic
929654900 2:43721041-43721063 AGGTTCTTACAGACCAGATAAGG + Intronic
931872836 2:66479861-66479883 AGATTTTTAAAGAGCAAATAGGG - Intronic
932585440 2:73025186-73025208 AGGTGCTTACTGAGCAAAGAGGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938556754 2:132431312-132431334 AGGATCTTACATCTGAAATAAGG - Intronic
939813944 2:146870959-146870981 AGGTCCTTACAGGTGAAAGAGGG + Intergenic
939919890 2:148097447-148097469 AGGTTCTTACTAATAATATATGG - Intronic
940437142 2:153668792-153668814 AGCTTCTTACAGAACGGATAAGG + Intergenic
941687920 2:168466629-168466651 ACATTCTTACAGATGAATTACGG - Intronic
942271919 2:174284671-174284693 AGGTTTTTATAGTTTAAATAGGG - Intergenic
942706849 2:178783564-178783586 ATGGTCTTCCAGACCAAATACGG + Intronic
944158775 2:196637403-196637425 AGTAGCTTACAGCTCAAATAAGG + Intergenic
945589262 2:211709438-211709460 AAATTCTTACAGATAAAACATGG - Intronic
1171100877 20:22382937-22382959 AGCTTCTTACAGATTTAAAACGG - Intergenic
1177261021 21:18730144-18730166 AGGTTCTTACCTGTCAGATATGG + Intergenic
1179221970 21:39416352-39416374 AGGTTCTTACTGGCCAAAGATGG - Intronic
1182208715 22:28654983-28655005 AGCTTTTTAGAGATTAAATATGG + Intronic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
952782922 3:37121621-37121643 AGGTTATTACAAACCAGATAAGG + Exonic
955560014 3:60178757-60178779 AGACTTTCACAGATCAAATAAGG + Intronic
957553362 3:81735226-81735248 TGGATCTTGGAGATCAAATATGG - Intronic
957726819 3:84076902-84076924 ATTTTCTTTCAGATAAAATAAGG + Intergenic
958024279 3:88032430-88032452 AGGAGCTCACAGATCAAAGAGGG - Intergenic
958724974 3:97894035-97894057 AGGGTCTTGAAGAACAAATATGG + Intronic
959138214 3:102451884-102451906 AGGTTGTTGCAGATTAAATTAGG - Intronic
959890285 3:111547109-111547131 AGTTTCTTACATAACAAATATGG + Intronic
963382023 3:144542507-144542529 AGGATCTTACAGTTGAAATGGGG + Intergenic
964987173 3:162757931-162757953 AGTTTGTTGCAGATCAAAGATGG + Intergenic
966713061 3:182989089-182989111 AGGTCTTTAGAGATCAAATGTGG + Intergenic
968127059 3:196167846-196167868 AGGCTCTTTCAGATCAACTTTGG - Intergenic
971103564 4:23497089-23497111 AGGTACTTACAGATGAAGAAGGG + Intergenic
971789146 4:31144927-31144949 AGGTACTTACAGATTATACAAGG - Intronic
972293188 4:37710879-37710901 AGTTTTATACAGATCAAATGTGG + Intergenic
973218186 4:47695430-47695452 AGGGTCTTAAAGATAAAATCTGG - Intronic
974409881 4:61526179-61526201 AAGTTCATACAGATGTAATAGGG + Intronic
974558373 4:63482477-63482499 AGGTTCTTACATATGAAAATGGG + Intergenic
974886281 4:67821748-67821770 ATGTTCTTACAGAATAATTAAGG + Exonic
978100283 4:104830417-104830439 AGTTTCAGAGAGATCAAATAAGG - Intergenic
978489193 4:109293179-109293201 AGCATCTTAAAGATCAAAAATGG + Intronic
978887892 4:113787292-113787314 AGGTTCTTACAGAGCTCTTAAGG + Intergenic
980686194 4:136232783-136232805 AGGTTCTTACAGATGTGACAGGG + Intergenic
981509137 4:145536115-145536137 AGGTTCTCACTGTTGAAATAAGG + Intronic
984194862 4:176646980-176647002 AGGTTCACACAGATGATATAGGG + Intergenic
986509843 5:8492482-8492504 AGGGACTTACAGGTCAAATGTGG + Intergenic
986833227 5:11605672-11605694 TGGTTCATAAAGATCACATAAGG + Intronic
987046000 5:14108895-14108917 AGGTCCTTAGAGATTAAAAATGG - Intergenic
988072503 5:26311967-26311989 ATGTTCTTACAGTTTAATTATGG + Intergenic
989088172 5:37698462-37698484 AGGGTCTTAAATATCACATAAGG + Intronic
990354493 5:54952599-54952621 AGGCTCTCACAATTCAAATAGGG + Intergenic
991195876 5:63931644-63931666 AGGTTCTTACACAGCTCATAAGG - Intergenic
993818267 5:92580840-92580862 AGGTTATTAAAGTTAAAATAGGG - Intergenic
994952134 5:106477094-106477116 AGGATCTTAAAGAACAAGTACGG - Intergenic
996819589 5:127611822-127611844 AGGTTATTGCAGATTGAATATGG - Intergenic
997806423 5:136922681-136922703 AGGTTCTTGCAGAGCAAATCTGG - Intergenic
998042790 5:138963651-138963673 AGGTTCTGACAGTTTAAATATGG + Intronic
998933319 5:147205307-147205329 AGTTTCTAACAGATAAAATTTGG + Intergenic
999601712 5:153273433-153273455 TACTTCTTCCAGATCAAATAAGG - Intergenic
999683417 5:154081159-154081181 AGTTCCTTACATATAAAATAGGG - Intronic
1002661824 5:180796546-180796568 ACTTTCTTAAAAATCAAATATGG - Intronic
1003223457 6:4182768-4182790 AGCTTCTTAAAAATAAAATAAGG - Intergenic
1006875861 6:37295646-37295668 AGGTTCTTACAGATCAAATAAGG + Intronic
1015004063 6:128256823-128256845 AGGGCGTTACAGACCAAATAAGG + Intronic
1015479896 6:133697431-133697453 AGGATCTTACTGTTCAAAGATGG + Intergenic
1015751141 6:136560523-136560545 AGATTATTACAGGTAAAATATGG + Intronic
1016852828 6:148638854-148638876 AGATTTTTAAATATCAAATAGGG + Intergenic
1017478660 6:154826987-154827009 AGCTTATTAGGGATCAAATAAGG + Intronic
1021163995 7:17311283-17311305 ATGTGCTTACAAATCACATAGGG + Intronic
1023283964 7:38599698-38599720 ATGTTCTTATACATCAAATTTGG + Intronic
1023667650 7:42541552-42541574 AGGGTCTTACAGGTCAAAGGTGG + Intergenic
1024443431 7:49448623-49448645 AGTTTCTTATAGATAATATATGG - Intergenic
1024792985 7:52987414-52987436 ATGTTCTTCCAGCTCAGATAAGG - Intergenic
1027673953 7:81136327-81136349 TCTTTCTCACAGATCAAATATGG + Intergenic
1029961803 7:104695638-104695660 AGGTCCATGCAGATGAAATAGGG + Intronic
1030191133 7:106811302-106811324 AGGTTCTTAAAAAACAAAAAGGG + Intergenic
1030912691 7:115271685-115271707 AGGATATAACAGAGCAAATAAGG - Intergenic
1033992546 7:147306066-147306088 GGGTTCTTACAGATACAATCAGG - Intronic
1035170284 7:157013565-157013587 TGGTTATTACAGAACAAAAAGGG - Intergenic
1038560998 8:28579932-28579954 TGATCCTTAAAGATCAAATAAGG + Intergenic
1038632567 8:29260551-29260573 AGGTTCCTACAGATCATACAAGG + Intronic
1038710759 8:29942386-29942408 AGGTTCTTGCAGTTTAATTAGGG - Intergenic
1038940396 8:32297996-32298018 ATGTTCTCACAGATAAACTAAGG - Intronic
1039258448 8:35744630-35744652 AGATTCTCACTGATCAAATCTGG - Intronic
1039939301 8:42075651-42075673 AGGTTCCTGAAGATCAAAGAGGG - Intergenic
1040356782 8:46626017-46626039 GGCATCATACAGATCAAATATGG + Intergenic
1041802237 8:61812875-61812897 AGGTTCCTAAAGATTAACTATGG - Intergenic
1042192149 8:66197919-66197941 AGGTGCTGACTGATCAAACAAGG + Intergenic
1042472294 8:69205160-69205182 AGGTTCTTACTGAAATAATAGGG - Intergenic
1043032711 8:75157471-75157493 AGGTTTTTAAAGATAAAAGATGG - Intergenic
1043602526 8:81958038-81958060 AGATTGTTACAGATGAAAGAAGG + Intergenic
1044386904 8:91599844-91599866 ATGTTCTACCAGATCAAATATGG + Intergenic
1045495878 8:102708108-102708130 AGTGTCTTACAGATGAAAGATGG + Intergenic
1047096758 8:121634275-121634297 AGCTTCTTCCAGATCCAAAATGG - Intronic
1048542498 8:135355285-135355307 AGCTTCTTACAAATAAAAGATGG - Intergenic
1048606317 8:135972132-135972154 ATTTTCTTACACATAAAATAGGG + Intergenic
1049962163 9:747277-747299 AAGTTCCTACAGATCCAAAATGG + Intergenic
1050050471 9:1595915-1595937 AGGGTCATACATATCCAATAGGG + Intergenic
1050450721 9:5779089-5779111 ATGTTTTTACAAGTCAAATATGG + Intronic
1050823411 9:9913378-9913400 AAGTGCTTTAAGATCAAATAGGG + Intronic
1052159162 9:25234124-25234146 GGGTTCTTACAAATGAAGTAAGG - Intergenic
1052405411 9:28053550-28053572 AGCTTGCTACAGATCAGATAAGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1056479677 9:86988443-86988465 AGGGTCTCACAGACCAAATCTGG - Intergenic
1057326431 9:94068935-94068957 GGGTTCTTACTGTCCAAATATGG - Intronic
1059354946 9:113691540-113691562 AGCTTCTTCCAGATAAAAAATGG - Intergenic
1059463678 9:114451711-114451733 AGGTTCTTACAGAACTTAGATGG - Intronic
1059835724 9:118149965-118149987 AGGTTATTACAAATCAGAAAAGG - Intergenic
1186631456 X:11353502-11353524 AGGTTGTTTCTGATTAAATAAGG - Intronic
1187997183 X:24940305-24940327 AGGCTCCTACAGACCAAAAACGG - Intronic
1190391551 X:49936621-49936643 AAGTTCTTGCAGTTTAAATAGGG - Intronic
1190599863 X:52079685-52079707 AAGTTCTTAGAGATCAAATGAGG + Intergenic
1190817765 X:53943853-53943875 AGGTTTTTACACACCAAAAAAGG + Intronic
1195410249 X:104562600-104562622 GGGTTCTTACAAATCAATTGGGG - Intergenic
1197643306 X:128990759-128990781 AGGTTCTTACACATATGATATGG + Intergenic
1198404259 X:136296640-136296662 AGGTTCTAACAGATCTAGTGTGG + Intergenic
1201337689 Y:12897932-12897954 ATGTTCTTACAGCTGAAGTAGGG + Intergenic