ID: 1006877230

View in Genome Browser
Species Human (GRCh38)
Location 6:37308377-37308399
Sequence CAGCAAAAAGCAGTGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1450
Summary {0: 1, 1: 0, 2: 5, 3: 109, 4: 1335}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006877230 Original CRISPR CAGCAAAAAGCAGTGGAGAA AGG (reversed) Intronic
900691065 1:3980937-3980959 CAGCAAAGAGGAGGGGAGAGAGG - Intergenic
901551023 1:9996455-9996477 CAGAGAAAAGCAAAGGAGAAGGG - Intergenic
903075571 1:20762441-20762463 CACCAAAAAGCAGAGAATAAAGG + Intronic
904637516 1:31894764-31894786 CAAAAACAAGCAATGGAGAATGG + Intergenic
904950778 1:34236881-34236903 CAGGAACAAGCAGAAGAGAAGGG - Intergenic
905937002 1:41832653-41832675 CAGCACAAAGCAGTGGTGCCTGG + Intronic
906648856 1:47496051-47496073 CAGCAAAGAGGACTAGAGAAAGG - Intergenic
906757751 1:48335521-48335543 CAACAACAAGCAATGGGGAAAGG + Intronic
906839131 1:49117479-49117501 CAAAAACAAGCAGTGGGGAAAGG - Intronic
906957810 1:50390317-50390339 CAAAAACAAGCAATGGAGAAAGG - Intergenic
907338409 1:53715865-53715887 CTGCAAACAGAAGTGGAGAATGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907572958 1:55500709-55500731 CAACAAAAATCAGTGGGGAATGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602967 1:55788546-55788568 CAGCAAAAAGCCATGGTGGACGG + Intergenic
907823590 1:57994128-57994150 CAGCAAAAGGCGGAGGACAAAGG + Intronic
907828675 1:58043031-58043053 CAGCACAAAGGAGTGTATAAAGG + Intronic
908106191 1:60844907-60844929 CAAAAACAAGTAGTGGAGAAAGG + Intergenic
908611026 1:65861307-65861329 CAAAAACAAGCAATGGAGAAAGG - Intronic
908684407 1:66699321-66699343 CAGCAATAAGGAGTGGAAGAGGG - Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908765685 1:67552953-67552975 CAGGACAGAGCAGTGAAGAAAGG - Intergenic
908864783 1:68535093-68535115 CAGAAACAAGTAATGGAGAAAGG + Intergenic
909163055 1:72179262-72179284 CAAAAAAAAGCAATGGGGAAAGG - Intronic
909178120 1:72385620-72385642 CAAAAACAAGCAATGGAGAAAGG - Intergenic
909275968 1:73687242-73687264 CAAAAACAAGCAATGGAGAAAGG - Intergenic
909438855 1:75674870-75674892 CAAAAACAAGCAATGGAGAATGG - Intergenic
909697956 1:78488686-78488708 CAAAAACAAGCAATGGAGAAAGG + Intronic
909715383 1:78701639-78701661 CAGCACAATGCAGTGGAGCAGGG + Intergenic
909862539 1:80626745-80626767 CAATAACAAGCAATGGAGAAAGG - Intergenic
909973175 1:82015272-82015294 CAGCATCAACCAGGGGAGAATGG - Intergenic
910044874 1:82901474-82901496 CAGCAAAAATAAGGGGAAAATGG - Intergenic
910331118 1:86073015-86073037 CAGGAAAAACCAGTGCAAAAGGG + Intronic
910368445 1:86490475-86490497 CAAGAAAAAACAGTGGACAAAGG - Intronic
910515107 1:88052428-88052450 CAGCAAAAGGGAGTGGTCAATGG - Intergenic
910571827 1:88714041-88714063 CAGAAACAAGAAATGGAGAAAGG - Intronic
910741535 1:90524372-90524394 CAAAAATAAGCAGTGAAGAAAGG + Intergenic
910912651 1:92253808-92253830 GAGGAAAAAGCAGCGGAAAAGGG + Intronic
911088547 1:93999697-93999719 CAGTAAGATGCAGAGGAGAAAGG + Intronic
911177637 1:94833112-94833134 CAGGAATAAACAGAGGAGAAGGG - Intronic
911692964 1:100856199-100856221 CAGAAATAAGCAATGGGGAAAGG - Intergenic
911744480 1:101425286-101425308 CAAAAACAAGCAATGGAGAAAGG - Intergenic
911901436 1:103510971-103510993 CAAAAACAAGCAATGGAGAAAGG - Intergenic
912028972 1:105215131-105215153 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
912141797 1:106738978-106739000 CAAAAACAACCAGTGGAGAAAGG - Intergenic
912770178 1:112456639-112456661 CAAGAGAAACCAGTGGAGAATGG + Exonic
913415208 1:118597826-118597848 CACCCTAAAGCAATGGAGAAAGG + Intergenic
913546637 1:119875302-119875324 CAAAAACAAGCAATGGAGAAAGG + Intergenic
914245119 1:145879831-145879853 CAACAAAAAGCAGAGCAGCAGGG - Intronic
915051746 1:153082699-153082721 CAGCAAAAAGCAGTGCTAACAGG + Intergenic
915053339 1:153101673-153101695 CAGCAAAAAGCAGTGCTAACAGG + Intronic
915288654 1:154868541-154868563 CAGGAAAATGGAGTGGAGCAGGG + Intronic
915587708 1:156853075-156853097 AGGAAAAAAGCAGTAGAGAAAGG - Intronic
916288467 1:163136895-163136917 CAAGAACAAGCAATGGAGAAAGG - Intronic
916448738 1:164898493-164898515 CAAAAACAAGCAATGGAGAAAGG + Intronic
916454012 1:164952061-164952083 CAGAAAAATTCAGTGGAAAATGG - Intergenic
916816580 1:168359673-168359695 CAAAAACAAGCAATGGAGAAAGG - Intergenic
916907284 1:169300816-169300838 CAAAAATAAGCAATGGAGAAAGG + Intronic
916929921 1:169566181-169566203 TAGCAAGAAGCATTGAAGAAGGG - Intronic
916940552 1:169672523-169672545 CAAAAACAAGCAATGGAGAAAGG + Intronic
917079491 1:171242203-171242225 CAACAACAAGCAATGGGGAAAGG + Intergenic
917162666 1:172075572-172075594 CAAAAAAAAGCAATGGGGAAAGG - Intronic
917593771 1:176506105-176506127 CAAAAACAAGCAATGGAGAAGGG - Intronic
917682345 1:177380167-177380189 CAGAAATAAGCAATGGGGAAAGG - Intergenic
917689580 1:177454416-177454438 CAAAAAGAAGCAGTGGGGAAAGG - Intergenic
917717353 1:177751939-177751961 CTGAAAAAAGCAGAGGAGAGGGG - Intergenic
917884846 1:179373708-179373730 CAAAAACAAGCAATGGAGAAAGG + Intronic
917900342 1:179536471-179536493 CAAAAACAAGCAATGGAGAAAGG - Intronic
917915693 1:179699174-179699196 CTGACAAAAGCAATGGAGAAAGG + Intergenic
918578216 1:186090956-186090978 AAGCATAAAGCATTGTAGAAGGG - Intronic
918583358 1:186158695-186158717 CAGAAACAAGCAATGGGGAAAGG - Intronic
918588692 1:186217324-186217346 CAGAAACAAGCAATGGGGAAAGG + Intergenic
918634815 1:186763315-186763337 CAGTAAGAAGTAATGGAGAATGG + Intergenic
918827216 1:189339699-189339721 CATAAACAAGCATTGGAGAAAGG + Intergenic
918943618 1:191032080-191032102 CAGAAACAAGCATTGGTGAAAGG + Intergenic
919176582 1:194026981-194027003 AAAAAAAAAGAAGTGGAGAAGGG - Intergenic
919226997 1:194717149-194717171 CAGTAACAAAGAGTGGAGAAAGG + Intergenic
919555749 1:199050791-199050813 CAAAAACAAGCAATGGAGAAAGG + Intergenic
919995388 1:202743725-202743747 CAAAAACAAGCAATGGAGAAAGG + Intronic
920042339 1:203109409-203109431 CAAAAAGAAGCAGTGGAGAAAGG + Intronic
920312341 1:205056125-205056147 CAGCTGAGAGCAGAGGAGAAAGG + Intronic
920538610 1:206759669-206759691 CAGCAAAGAACGGGGGAGAAGGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920763197 1:208805554-208805576 CCAAAAAAAGCAATGGAGAAAGG - Intergenic
920812058 1:209295528-209295550 CTCTAAAAAGCAGTGAAGAAAGG + Intergenic
920999284 1:211026425-211026447 CAGCCAAAAGGAGTGGAAAATGG + Intronic
921357365 1:214298285-214298307 CAGAAATAAGCAATGGGGAAAGG + Intronic
921416059 1:214888328-214888350 CAAAAACAAGCAATGGAGAAAGG - Intergenic
921495916 1:215841426-215841448 CAAAAACAAGCAGTGGGGAAAGG + Intronic
921955783 1:220982024-220982046 CAGCATAGCGCAGGGGAGAAGGG - Intergenic
921966434 1:221095589-221095611 CAGAAACAAGCAATGGGGAAAGG + Intergenic
922196108 1:223362445-223362467 CAGCAATGAGCAGTGGAGGCAGG + Intronic
922611742 1:226935379-226935401 CAGCACAAAAGAGGGGAGAATGG + Intronic
922778736 1:228232792-228232814 CTGCTTGAAGCAGTGGAGAACGG - Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923179718 1:231504552-231504574 CAAAAACAAGCAATGGAGAAAGG - Intergenic
923902044 1:238336576-238336598 CAGCCAATGGCATTGGAGAAGGG + Intergenic
924073428 1:240307504-240307526 CAGAAATAAACAATGGAGAAAGG - Intronic
924132502 1:240926399-240926421 CAAAAATAAGCAATGGAGAAAGG - Intronic
924162121 1:241243966-241243988 AAGCTAAAAGTAGTGGAGCAAGG + Intronic
924652709 1:245944868-245944890 CTGACAAAAGCAATGGAGAAAGG + Intronic
924900728 1:248396119-248396141 CAGAAACAAGCAATAGAGAAAGG + Intergenic
1062768808 10:84040-84062 CAGGACCAAGCAGTGGAGAGGGG + Intergenic
1063191113 10:3695861-3695883 GAGCAGAAAGCAGTGGGAAATGG + Intergenic
1063357631 10:5415985-5416007 CAGAAGAAAGCACTGGGGAAAGG - Intronic
1063461208 10:6216000-6216022 CAGCGCTAAGCAGTGTAGAATGG + Intronic
1063844836 10:10115340-10115362 CAAAAATAAGCAGTGGAGAAAGG - Intergenic
1063873710 10:10448168-10448190 CAACCAAAAGAAGTAGAGAAAGG - Intergenic
1063901268 10:10734680-10734702 AAGGAAATAGGAGTGGAGAAAGG + Intergenic
1064707132 10:18084737-18084759 CTGCAAAAAGCAGTGAAGTCTGG - Intergenic
1064818855 10:19300590-19300612 CAATAAAAAGCAATGGGGAAAGG + Intronic
1064975156 10:21106445-21106467 CAGAAACAAGCAATGGGGAAAGG - Intronic
1065182587 10:23141636-23141658 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1065461713 10:25973822-25973844 CAAAAACAAGCAATGGAGAAAGG + Intronic
1065961509 10:30737804-30737826 CAGCAAAAAAGACTGGTGAAGGG - Intergenic
1066140037 10:32495651-32495673 GAAAAACAAGCAGTGGAGAAAGG - Intronic
1066257530 10:33695398-33695420 GAGGAAAAACCAGTGCAGAAAGG - Intergenic
1066509359 10:36078853-36078875 CAACAACAAGCAATGGGGAAAGG - Intergenic
1066626179 10:37408057-37408079 CAAAAAAAAGCAATGGGGAAAGG + Intergenic
1066699329 10:38110217-38110239 CTGAAAAAAGCAATGGGGAAAGG + Intronic
1067675860 10:48376119-48376141 CAAAAACAAGCAGTGGGGAAAGG + Intronic
1068141984 10:53020553-53020575 GAGCAAAAAGCACTCAAGAATGG + Intergenic
1068166818 10:53341672-53341694 CAGAAACAAGCAATGGGGAAAGG - Intergenic
1068214487 10:53966403-53966425 AAGCAAAAAGAAGGGAAGAAGGG - Intronic
1068341284 10:55706781-55706803 CAGTAACAAGCTGTGGGGAAGGG + Intergenic
1068409595 10:56637667-56637689 CAAAAACAAGCAGTGGTGAAAGG - Intergenic
1068504793 10:57886811-57886833 CACAAACAAGCAATGGAGAAAGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068820532 10:61372575-61372597 CAACAACAAGCAATGGGGAATGG - Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069046150 10:63745656-63745678 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1069097533 10:64277788-64277810 CAGCAAAAGCCAGTACAGAAAGG - Intergenic
1069344293 10:67449541-67449563 CAAAAACAAGCAATGGAGAAAGG + Intronic
1069625046 10:69862623-69862645 CCTCAAAGAGCAGTGAAGAAGGG - Intronic
1070082934 10:73206634-73206656 CAGCAAAAAGCAGTGTCCCAAGG - Intronic
1070084085 10:73218133-73218155 CAGTTAAAAGGAGTGGGGAATGG + Intronic
1070161166 10:73867525-73867547 CAGCAGCAAGCAGGGGGGAAGGG + Intronic
1070516346 10:77211336-77211358 CAAAAACAAGCAGTGGGGAAGGG + Intronic
1070681244 10:78450963-78450985 CAGCAACACCCAGTGGAGATAGG + Intergenic
1071059488 10:81553003-81553025 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071126801 10:82345323-82345345 CAAAAACAAGCAATGGAGAAAGG - Intronic
1071190523 10:83094058-83094080 CAAGAACAAGCAGTGGGGAAAGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071412579 10:85411468-85411490 CAGAAACAAGCAATGGGGAAAGG - Intergenic
1071991800 10:91106995-91107017 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1072393091 10:95009228-95009250 CAAAAACAAGCAGTGGCGAATGG - Intergenic
1072478478 10:95786338-95786360 GAGCAATAAGCAATGGAGGATGG + Intronic
1072819945 10:98546535-98546557 CAAAAAAAAGCAATGGGGAAAGG + Intronic
1073673790 10:105622071-105622093 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1073816319 10:107211792-107211814 CAGCAAAAAGCAGTGTTAAGGGG - Intergenic
1073872028 10:107876671-107876693 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1074028063 10:109657233-109657255 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1074379253 10:112965336-112965358 CAGCAGAATGCAGTAGAGGAGGG + Intronic
1074543227 10:114383701-114383723 CAACAAAAAGAAGAGGAGAAAGG + Intronic
1074746271 10:116535948-116535970 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1074766313 10:116702471-116702493 CAGCAAATATCAGTGGAGGCCGG - Intronic
1074795043 10:116934427-116934449 CAAAAACAAGCAATGGAGAAAGG - Intronic
1074844312 10:117383697-117383719 CAGATCAAGGCAGTGGAGAAAGG - Intergenic
1074995235 10:118751468-118751490 CATCATAAACCACTGGAGAAAGG - Intronic
1075454405 10:122575900-122575922 CAGCACAGAGCTGTGGAGATGGG - Intronic
1076038078 10:127217947-127217969 AAGAAAAAAGCAATGGGGAAAGG - Intronic
1076099935 10:127768616-127768638 CAAACAAAAACAGTGGAGAAAGG + Intergenic
1076174520 10:128357482-128357504 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076665609 10:132088967-132088989 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1076947052 10:133658604-133658626 CACCAGAAAGCAGTGGGGACTGG - Intergenic
1077655174 11:4011983-4012005 CAAAAACAAGCAATGGAGAAGGG - Intronic
1077876156 11:6308369-6308391 GAGCATAAAGTAGTAGAGAAAGG - Intergenic
1077966310 11:7137398-7137420 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1078217822 11:9326565-9326587 CAGTAACAAGCAATGGGGAAAGG + Intergenic
1078273880 11:9824028-9824050 CAGCAGAAAGTATTTGAGAAGGG + Intronic
1078331042 11:10421371-10421393 CAGAAACAAGCAATGGGGAAAGG - Intronic
1078742970 11:14085406-14085428 AAAAAAAAAGCAGTGGGGAAAGG - Intronic
1079258929 11:18858891-18858913 CAGAAATAAGCAATGGAAAAAGG + Intergenic
1079429266 11:20373116-20373138 CAGAGAACAGCAATGGAGAAAGG + Intronic
1079636267 11:22745343-22745365 CAAAAATAAGCAATGGAGAAAGG + Intronic
1079713328 11:23713673-23713695 CAAAAATAAGCAATGGAGAAAGG - Intergenic
1079847123 11:25486788-25486810 CACCAAAAAGAAGTGAAAAATGG - Intergenic
1079983506 11:27176648-27176670 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1080023518 11:27589546-27589568 CAAAAATAAGCAATGGAGAAAGG - Intergenic
1080122926 11:28698088-28698110 CAGCAAATAGCAGTTGAGGCTGG - Intergenic
1080321024 11:31009662-31009684 GAACAAAAAGCAGAGGAGAGGGG - Intronic
1080561335 11:33465725-33465747 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1080890571 11:36405613-36405635 CAGCAATGAGCAGTGGCAAAAGG + Intronic
1081061939 11:38490000-38490022 CAGCAACAAGCAATGGGGAAAGG - Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081081171 11:38741003-38741025 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1081084791 11:38786357-38786379 CAGAAAAAAGCACTGGACATTGG - Intergenic
1081272395 11:41100923-41100945 CAGAAACAAGCAATGGAAAAAGG + Intronic
1081593372 11:44442170-44442192 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1082643978 11:55699578-55699600 CAGAAACAAGCAATGGGGAAAGG - Intergenic
1082688229 11:56266893-56266915 CAAAAAAAAGCAATGGGGAAAGG + Intergenic
1082746938 11:56973868-56973890 CAGAAGTAAGCAATGGAGAAAGG + Intergenic
1083328853 11:61887571-61887593 CAGCAGAGAGCAGTGGAGAGAGG - Intronic
1083532291 11:63435173-63435195 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1084623870 11:70293264-70293286 CTGGAAAAAGCAATGAAGAAGGG - Intronic
1084797226 11:71515916-71515938 CAAAAACAAGCAATGGAGAAAGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085220252 11:74867879-74867901 CAGCACAAACCAGAGGAGAATGG + Intronic
1085379528 11:76101840-76101862 CAAAAACAAGCAATGGAGAAAGG - Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085698318 11:78724551-78724573 CATCATATATCAGTGGAGAATGG - Intronic
1086050201 11:82580381-82580403 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1086282318 11:85204913-85204935 CAAGAAAATGCATTGGAGAAGGG + Intronic
1086283463 11:85218041-85218063 CAAAAACAAGCAATGGAGAAAGG - Intronic
1086308782 11:85512137-85512159 CAGCAATAAGCACAGGAGAAAGG + Intronic
1086313052 11:85557687-85557709 CAAAAACAAGCAATGGAGAAAGG + Intronic
1086469060 11:87086963-87086985 CAGCAGAAAGCAGTTAAGACTGG - Intronic
1086531633 11:87793124-87793146 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1086671308 11:89551043-89551065 CACCAACAAGCAATGGGGAAAGG - Intergenic
1086818348 11:91401882-91401904 CAAAAACAAGCAGTGGAGAAAGG + Intergenic
1086976183 11:93135734-93135756 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1087107742 11:94428273-94428295 CAAAAACAAGCAATGGAGAAAGG + Intronic
1087155856 11:94902423-94902445 CAGAAACAAGCAATGGGGAAAGG - Intergenic
1087308922 11:96517468-96517490 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1087370363 11:97276409-97276431 CTGACAAAAGCAATGGAGAAAGG + Intergenic
1087439799 11:98168923-98168945 TAAAAATAAGCAGTGGAGAAAGG + Intergenic
1087481996 11:98713724-98713746 CACAAACAAGCAATGGAGAAAGG - Intergenic
1087604557 11:100361337-100361359 CAAAAATAAGCAATGGAGAATGG - Intergenic
1087694127 11:101356163-101356185 CAGCTAAAATCAGTGGAGCAGGG + Intergenic
1087698985 11:101414040-101414062 CAGCAAAAACCAACAGAGAAAGG - Intergenic
1087735677 11:101830158-101830180 CAAAAATAAGCAATGGAGAAAGG + Intronic
1087749786 11:101994628-101994650 CAGAAACAAGCAATGGGGAACGG - Intronic
1088091639 11:106046810-106046832 CAAATAAAAGAAGTGGAGAAAGG - Intergenic
1088149932 11:106732258-106732280 CAGAAACAAGCAATAGAGAAAGG + Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088380622 11:109188649-109188671 CAGAAAAAAGAAATGGGGAAAGG - Intergenic
1088606439 11:111538044-111538066 TAGCCAAAAGAAGTGGAGAATGG + Intergenic
1088661159 11:112047724-112047746 CAACAACAAGCAATGGGGAAAGG - Intronic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1088933979 11:114380019-114380041 ATGCAAAAAGCTTTGGAGAAGGG + Intergenic
1088945533 11:114508624-114508646 CAGAAACAAGTAATGGAGAAAGG + Intergenic
1088999541 11:115040062-115040084 AAGGAGAAAGAAGTGGAGAAAGG - Intergenic
1089160248 11:116431895-116431917 CAGCAAAATGGAGTTGTGAAGGG - Intergenic
1089312095 11:117565128-117565150 CAGAAAAAAGCAGGTGAGAAGGG - Intronic
1089594060 11:119564983-119565005 CAGCAACAAGAAATGGGGAAAGG + Intergenic
1089655265 11:119942475-119942497 CTCCAAGAAACAGTGGAGAATGG - Intergenic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1089951151 11:122528049-122528071 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1090855452 11:130606667-130606689 AAGCAAAGAGCAGAGGTGAAGGG - Intergenic
1090881511 11:130836068-130836090 CAGCAAAAAACCGTTAAGAATGG - Intergenic
1090980686 11:131718968-131718990 CTGCTATAAGCAGTGGACAAAGG - Intronic
1091877772 12:3950640-3950662 CGGCTAAGAGCAGTGGAAAATGG + Intergenic
1092621848 12:10280756-10280778 CAGCAAAAAAGCATGGAGAATGG + Intergenic
1092645424 12:10565747-10565769 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1093290016 12:17308473-17308495 CAGGGAAGAGAAGTGGAGAAGGG - Intergenic
1093413208 12:18891490-18891512 CAAAAACAAGCAATGGAGAAGGG - Intergenic
1093693462 12:22133855-22133877 CAAAAACAAGCAGTGGGGAAAGG - Intronic
1094225825 12:28044684-28044706 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1094290254 12:28840249-28840271 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1094299388 12:28944904-28944926 CAAAAAAAAGCAATGGGGAAAGG - Intergenic
1094336634 12:29364338-29364360 CAAAAATAAGCAATGGAGAAAGG + Intronic
1094434431 12:30405442-30405464 CAAAAATAAGCAATGGAGAAAGG - Intergenic
1095191641 12:39264604-39264626 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1095208968 12:39470912-39470934 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1095400426 12:41808455-41808477 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1095846011 12:46745767-46745789 CAAAAATAAGCAGTGGATAAGGG + Intergenic
1095885093 12:47180353-47180375 CAAAAACAAGCAATGGAGAAAGG + Intronic
1096025907 12:48360797-48360819 CAGAAAAAAGCAGATGACAATGG - Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096816738 12:54206430-54206452 CAGCAAGAAGCAGAGGAGGTGGG + Intergenic
1096928435 12:55175381-55175403 CAGCATCAAGGAGTGGAGGAAGG - Intergenic
1096931425 12:55214113-55214135 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1097130157 12:56805590-56805612 CAGCATGAAGCAGTTAAGAATGG - Intergenic
1097303040 12:58038547-58038569 CAACAACAAGCAATGGGGAAAGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097662071 12:62441054-62441076 CAAAAATAAGCAATGGAGAAAGG - Intergenic
1097936948 12:65263364-65263386 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1097989208 12:65817542-65817564 CTTCTAAAAGCAGTGAAGAATGG + Intergenic
1098448002 12:70587270-70587292 GAGGAAAAAGCAATGGAGATGGG + Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098696197 12:73558998-73559020 CAAAAATAAGCAGTGAAGAAAGG + Intergenic
1098791711 12:74832467-74832489 CAGAAACGAGCAATGGAGAAAGG + Intergenic
1098839561 12:75462377-75462399 CAGAAACAAGCAATGGGGAAAGG - Intergenic
1098872331 12:75830662-75830684 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099058998 12:77882311-77882333 CAAAAACAAGCAGTGGGGAAAGG + Intronic
1099271950 12:80521622-80521644 CAAAAAAAAGCAATGGGGAAAGG - Intronic
1099489695 12:83273230-83273252 CAGAAACAAGCAATGGAGAAAGG - Intergenic
1099556195 12:84110630-84110652 CAGAAACAAGCATTGGGGAAAGG + Intergenic
1099577435 12:84399374-84399396 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1099701476 12:86088109-86088131 CAAAAACAAGCAGTGGGGAAAGG + Intronic
1099767244 12:87003101-87003123 CAAAAACAAGCAGTGGAGAAAGG - Intergenic
1099768798 12:87025582-87025604 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1099774202 12:87103149-87103171 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1099967825 12:89469548-89469570 CAGAGAAAAACAGTGAAGAATGG + Intronic
1100087429 12:90928913-90928935 CAAAAACAAGCAATGGAGAAAGG + Intronic
1100758234 12:97776128-97776150 CACCATAATGCAGTGGAGACAGG + Intergenic
1101067014 12:101032313-101032335 CAGAAACAAGCAATGGGGAAAGG + Intronic
1101206163 12:102489731-102489753 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1101655561 12:106717078-106717100 CAGGAAAAAGCAGAAGAGGAAGG - Intronic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1102508979 12:113401791-113401813 CAGCAGAAGGCAGGGGAGATGGG - Intronic
1102519832 12:113471445-113471467 CAGCAGAAAGCGGTCGAGGATGG + Exonic
1103169700 12:118805827-118805849 CAGTAACAAGCAATGGGGAAAGG - Intergenic
1103742753 12:123102361-123102383 GAGCAAAGGGCAGTTGAGAATGG + Intronic
1104073382 12:125368122-125368144 TAGCACAAAGATGTGGAGAATGG - Intronic
1104297948 12:127535293-127535315 CAAAAACAAGCGGTGGAGAAGGG - Intergenic
1104331446 12:127850371-127850393 TAGAAACAAGCAATGGAGAAAGG - Intergenic
1104404484 12:128506207-128506229 CAGGAGAAAGCAGTGGGGAATGG + Intronic
1104507594 12:129347440-129347462 CAAAAACAAGCAATGGAGAAAGG + Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105317642 13:19281610-19281632 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1105340979 13:19525428-19525450 CAAAAACAAGCAATGGAGAAAGG + Intronic
1105441287 13:20416988-20417010 CAGAAAGAAGCAGTGAGGAAGGG - Intronic
1105445357 13:20450321-20450343 CAAAAATAAGCAGTGAAGAAAGG + Intronic
1105537576 13:21282863-21282885 AAGCAATAAACAGGGGAGAAGGG + Intergenic
1105632626 13:22185914-22185936 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1105835316 13:24205816-24205838 CAAAAACAAGCAATGGAGAAAGG + Intronic
1105985950 13:25567314-25567336 CAGGAAAAAGCAGTGGGTAGGGG - Intronic
1106032305 13:26014148-26014170 CACGAAAAAGCAGGGGAGCAGGG - Intronic
1106052310 13:26203241-26203263 CAGAGGAGAGCAGTGGAGAAGGG + Intronic
1106430043 13:29672150-29672172 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1106440220 13:29760141-29760163 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1106767710 13:32931597-32931619 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1106886808 13:34195186-34195208 CAGAAAAAAAGAGTGGATAAAGG + Intergenic
1106984222 13:35325915-35325937 CAACAATAAGCAATGGAGAAAGG - Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107422466 13:40261274-40261296 CACCAAAAAGCAGTGTCAAAAGG + Intergenic
1107661196 13:42641402-42641424 CAAAAAAAAGCAATGGGGAAAGG - Intergenic
1107895853 13:44962309-44962331 CAATATAATGCAGTGGAGAAAGG - Intronic
1108132292 13:47315677-47315699 CAAGAAAAAGCAATGGGGAAAGG - Intergenic
1108145081 13:47468414-47468436 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1108172299 13:47754148-47754170 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1108827238 13:54428246-54428268 CAGCAAATACCATTGAAGAAGGG - Intergenic
1109426712 13:62173960-62173982 CAACAAAAAAAATTGGAGAATGG + Intergenic
1109640482 13:65185070-65185092 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109879528 13:68452769-68452791 CACCAAACAGGATTGGAGAATGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110000661 13:70195023-70195045 CAAAAAGAAGCAATGGAGAAAGG - Intergenic
1110310057 13:74038460-74038482 CGACAAAAAGCAGTGCAGGAGGG + Intronic
1110358785 13:74600818-74600840 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1110502491 13:76244708-76244730 CAGCATAACTCAGTGGAGGATGG + Intergenic
1110504123 13:76264840-76264862 CAGAAACAAGCAATGGAGAAAGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110730142 13:78870904-78870926 CAGCAAGAAGCTGTAAAGAAAGG + Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111038246 13:82707261-82707283 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1111056565 13:82958035-82958057 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1111133055 13:84000528-84000550 CAGCAAGAAGCAGTTAAGATCGG + Intergenic
1111183500 13:84698846-84698868 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1111379253 13:87424963-87424985 CAGAAAGAAGCAATGGAGAAAGG - Intergenic
1111464876 13:88595331-88595353 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111899547 13:94183982-94184004 CAAAAACAAGCAATGGAGAAAGG + Intronic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG + Intergenic
1112091105 13:96085117-96085139 CAGGAAAAAGCAAAGAAGAAGGG + Intergenic
1112475047 13:99723986-99724008 CAGCAAAAAGGATAAGAGAAAGG - Intronic
1112648052 13:101357917-101357939 CAAAAACAAGCAGTGGGGAAAGG + Intronic
1112782781 13:102919685-102919707 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1113339508 13:109408478-109408500 GAGCAGAAAGCAGTGGCTAAAGG + Intergenic
1113370787 13:109723522-109723544 GAGAAAACAGCAGTGCAGAAGGG + Intergenic
1113607374 13:111619951-111619973 CAGCAAAAAGCAGAGTGGACCGG - Intronic
1114373700 14:22119219-22119241 CAGCAAAAAGTATGGGAGATCGG + Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114603507 14:23975838-23975860 CAGAAACAAGCAATGGGGAAAGG + Intronic
1114608519 14:24018608-24018630 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1114937257 14:27556125-27556147 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1114971832 14:28040817-28040839 CAAAAACAAGCAGTGGAAAAAGG - Intergenic
1115018334 14:28643869-28643891 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1115042674 14:28950144-28950166 CAAGAACAAGCAATGGAGAAAGG - Intergenic
1115045149 14:28982850-28982872 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1115046139 14:28996795-28996817 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1115242325 14:31261864-31261886 CAGGAAAAAACAGTGGGGAGGGG + Intergenic
1115300246 14:31877256-31877278 CAGCAAAAAGTGCTGAAGAAAGG - Intergenic
1115391938 14:32863687-32863709 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1115764638 14:36610889-36610911 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1115875781 14:37859650-37859672 CATCACAAAGCAGTGGACAAAGG - Intronic
1116033067 14:39596301-39596323 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1116092035 14:40321419-40321441 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1116103464 14:40470159-40470181 CAGCAGAAAGCAGTTAAGATAGG + Intergenic
1116331985 14:43608814-43608836 AAGCACAAAGCACTGAAGAAAGG - Intergenic
1116358856 14:43967225-43967247 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1116501066 14:45622640-45622662 CAGCAAAAAGAAGGGTATAAAGG + Intergenic
1116578752 14:46610410-46610432 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1116649423 14:47570637-47570659 CAGAAACAAGCAATGGGGAAAGG + Intronic
1116943561 14:50814772-50814794 CAAAAACAAGCAGTGGGGAAAGG + Intronic
1117121193 14:52569329-52569351 GAGGAAAAACCAGTGCAGAAAGG + Intronic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1117342070 14:54800766-54800788 CTACAACAAGCAATGGAGAAAGG + Intergenic
1117466054 14:55995307-55995329 CAAAAAAAAGCAATGGGGAAAGG - Intergenic
1117561378 14:56942742-56942764 CAATAACAAGCAATGGAGAAAGG - Intergenic
1117616594 14:57540057-57540079 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1117624906 14:57625682-57625704 CAAAAACAAGCAATGGAGAAAGG + Intronic
1117671750 14:58114823-58114845 CAATAACAAGCAATGGAGAAAGG + Intronic
1117711164 14:58530573-58530595 CAGAAACAAGCAATGGGGAAAGG + Intronic
1117751462 14:58928556-58928578 CAAAAACAAGCAATGGAGAATGG + Intergenic
1117822352 14:59663147-59663169 CAAGAACAAGCAGTGGGGAAAGG + Intronic
1117901708 14:60540640-60540662 CAAAAAAAAGCAGTGGAGAAAGG - Intergenic
1117959740 14:61151049-61151071 CAGTAATAAGGAGTGTAGAAAGG + Intergenic
1118064595 14:62177372-62177394 CAGAAAAAAGTAATGGGGAAAGG + Intergenic
1118097917 14:62560321-62560343 CAGAAACAAGCAATGGGGAAAGG - Intergenic
1118415610 14:65532894-65532916 CAAAAACAAGCAATGGAGAAAGG - Intronic
1118494973 14:66299336-66299358 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1118513128 14:66498325-66498347 CAGGAAAAAACAGAGGAAAAAGG - Intergenic
1118950430 14:70431979-70432001 AAGCATCCAGCAGTGGAGAAAGG + Intergenic
1118981073 14:70717596-70717618 CAGTAAGATGCAGTGGGGAATGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119258092 14:73217186-73217208 CAGCAACAGCCAGTGGAGACTGG + Exonic
1119895416 14:78215681-78215703 CAGGAAACAGCTGTGGACAAGGG - Intergenic
1120083695 14:80244754-80244776 CACTGCAAAGCAGTGGAGAAGGG + Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120238784 14:81925311-81925333 CAGGGAAAAGCAGAGGAGAATGG - Intergenic
1120638299 14:86978827-86978849 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1122589228 14:102834322-102834344 CTGACAAAAGCAGTGGGGAAAGG + Intronic
1202921118 14_KI270723v1_random:31159-31181 CACCAGAAAGCAGTGGGGACTGG - Intergenic
1202923792 14_KI270724v1_random:6421-6443 CACCAGAAAGCAGTGGGGACTGG + Intergenic
1123991250 15:25685165-25685187 CAATAAAAAGCAGAGAAGAAAGG - Intronic
1124030713 15:26008686-26008708 CATCAAAGACCAGTGGAGCACGG - Intergenic
1124084644 15:26536295-26536317 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1124151829 15:27187184-27187206 CAATAAAAAGCAATGGAAAAAGG - Intronic
1124197362 15:27643977-27643999 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1124286729 15:28406719-28406741 CAGCAAAAAGCAGTAGTAAGAGG - Intergenic
1124295974 15:28504917-28504939 CAGCAAAAAGCAGTAGTAAGAGG + Intergenic
1124434793 15:29638181-29638203 CAGCAAAAAACAGTGGCTATGGG + Intergenic
1124669797 15:31628352-31628374 CAGAAACAAGCAATGGGGAAAGG - Intronic
1124924007 15:34053560-34053582 CAAAAACAAGCAGTGGGGAAAGG + Intronic
1125048837 15:35274134-35274156 CAAAAACAAGCAATGGAGAAAGG + Intronic
1125130649 15:36280147-36280169 CAAAAATAAGCAGTAGAGAAAGG - Intergenic
1125259010 15:37800971-37800993 TAGCAAATAGCAGATGAGAAAGG - Intergenic
1125384224 15:39120023-39120045 CAAAAATAAGCAGTGGGGAAAGG + Intergenic
1125400094 15:39293027-39293049 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1125714289 15:41810418-41810440 CAGGAGAAAGCAGTGGAGGCTGG + Intronic
1126103472 15:45133620-45133642 AGCCAAAAAGCAGTGGAGCAGGG - Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126284136 15:46992011-46992033 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1126285568 15:47007082-47007104 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1126554525 15:49971002-49971024 CAAAAACAAGCAATGGAGAAAGG + Intronic
1126829729 15:52588973-52588995 AAGTAAAAAGGAGTGGATAAAGG + Intronic
1126843053 15:52735627-52735649 CAGCAAAACCCAGGGGAAAAGGG - Intergenic
1126853760 15:52817298-52817320 CACACACAAGCAGTGGAGAAAGG - Intergenic
1127011940 15:54641004-54641026 CAGTAAAAAGCAGACAAGAAGGG + Intergenic
1127022047 15:54759225-54759247 CAACAACAAGCAATGGGGAAAGG + Intergenic
1127218429 15:56849883-56849905 CAGCAAAAAGCAGGGGTCAGAGG + Intronic
1127258154 15:57308290-57308312 CAGGCTAAAGCAGTGGAGACGGG - Intergenic
1127452128 15:59126806-59126828 CAACAACAAGCAATGGGGAAAGG - Intergenic
1127659650 15:61088457-61088479 AAGCAAAAAGCGGTGGGGGATGG + Intronic
1127696576 15:61454194-61454216 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1128023354 15:64413081-64413103 TAGCAAGAAGGAGTGGAGAAAGG + Intronic
1128792777 15:70445283-70445305 CAGCAAAAAGCAGAGAAAAATGG - Intergenic
1128884128 15:71270332-71270354 CAAAAACAAGCACTGGAGAAAGG + Intronic
1129569031 15:76658801-76658823 CAAGAACAAGCAGTGGGGAAAGG + Intronic
1129736408 15:77967819-77967841 TAGGAAAAAGCAATGGAGAGTGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130124030 15:81077567-81077589 CAAAAAAAAGCAATGGGGAAAGG - Intronic
1130252593 15:82309826-82309848 TAGCAAAAAGCAATGGAGGGTGG - Intergenic
1130323860 15:82863046-82863068 CACAAAGAAGCAGTGGAGAGAGG - Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131569904 15:93524121-93524143 CAGGAAAAAGGAAGGGAGAAGGG - Intergenic
1131639719 15:94278901-94278923 CAATAACAAGCAATGGAGAAAGG - Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131796764 15:96026426-96026448 CACCAAGAAGTAGAGGAGAATGG - Intergenic
1132007745 15:98244969-98244991 CAGTAACAAGCAATGGGGAAAGG - Intergenic
1132259910 15:100414660-100414682 CAAAAACAAGCAGTGGGGAAAGG + Intronic
1132397360 15:101483727-101483749 GAGAAAGAAGCAGGGGAGAAGGG + Intronic
1132948194 16:2544435-2544457 GAACAAAAATTAGTGGAGAAAGG - Intronic
1133092623 16:3416231-3416253 CAACAAAAAACAGAGTAGAATGG - Intronic
1133499455 16:6352013-6352035 CAGAAAAAAGCACTGAAAAAGGG - Intronic
1133539138 16:6731788-6731810 TAGGAAACAGCAGTGGGGAAGGG - Intronic
1133553107 16:6877947-6877969 TAGCAAAAAGTAGGGGATAAGGG + Intronic
1134129204 16:11637228-11637250 CACCACAGAGAAGTGGAGAAGGG + Intergenic
1134224205 16:12379086-12379108 CAGGAAACAGGAGTGGAGTATGG - Intronic
1134667803 16:16031913-16031935 CAGCTAAAAGCGGTGGAGTGAGG - Intronic
1134790715 16:16986928-16986950 CCTCCAAAAGCAGTGAAGAAAGG - Intergenic
1134873370 16:17672719-17672741 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1135226756 16:20666827-20666849 CAAAAATAAGCAATGGAGAAAGG + Intronic
1135388744 16:22070189-22070211 CAGCAAAGAACAGTGAAGCACGG + Intronic
1135911238 16:26562973-26562995 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1138178011 16:54919866-54919888 CAGAGAAAAGCAATGGAAAAGGG + Intergenic
1138516421 16:57537556-57537578 CTGCAAAAACCAGTTCAGAAGGG - Intergenic
1138943869 16:61823589-61823611 CAGAAAAAAACATTGGAGGAAGG + Intronic
1139125274 16:64070337-64070359 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1140683042 16:77404051-77404073 CTGCAGAAAGCAGAGGAAAAGGG - Intronic
1141098611 16:81180676-81180698 CAGGGAAAAGCAGTGCAGAGAGG + Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142228696 16:88889381-88889403 CAGGAAAAAGCAGAGGAGGCAGG + Intronic
1142424545 16:89994356-89994378 CAGCAAAGAGCTGCGGAGCATGG - Intergenic
1143337489 17:6183796-6183818 CAAAAATAAGCAGTGGGGAAAGG + Intergenic
1143426870 17:6846847-6846869 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1144025404 17:11272381-11272403 CACCAAGGACCAGTGGAGAAAGG - Intronic
1145327140 17:21842181-21842203 CGGCAAAAAGCTGTGGCGACGGG - Intergenic
1145327479 17:21843483-21843505 CGGCAAAAAGCTGTGGAGACGGG - Intergenic
1146116190 17:30141426-30141448 CAGCAAAAAGTGGAGGAAAAAGG - Intronic
1146580652 17:34035241-34035263 CAGAAACAAGCAATGGGGAAAGG + Intronic
1146586212 17:34084304-34084326 CAGAAACAAGCAATGGGGAAAGG - Intronic
1146613892 17:34335678-34335700 CAAAAACAGGCAGTGGAGAAAGG - Intergenic
1146615477 17:34353927-34353949 CAAAAATAAGCAATGGAGAAAGG - Intergenic
1146647801 17:34586716-34586738 CAGCAAGATGAAGTGGAAAATGG + Intronic
1147388127 17:40093548-40093570 CAGCAAAAAGCAAGGGAGTCTGG - Exonic
1148229740 17:45924439-45924461 CAGCAAAGAGGAGTGGAGGCCGG - Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149092612 17:52802345-52802367 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1149181412 17:53941996-53942018 CTGCAAAAAGCACTGCACAAAGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149246129 17:54710648-54710670 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1149280782 17:55103390-55103412 CAAAAACAAGCAATGGAGAAAGG - Intronic
1149801943 17:59577465-59577487 CATCAAAAAGTAGGAGAGAAGGG - Intronic
1149844547 17:59998016-59998038 CATCAAAAAGTAGGAGAGAAGGG + Intergenic
1150253779 17:63726870-63726892 AGGCAAAGAGGAGTGGAGAAAGG - Intronic
1150411173 17:64941765-64941787 CAGGATAAAGGGGTGGAGAAAGG - Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151654057 17:75487358-75487380 CAGCAGAGAACAGTGGAGAGAGG - Intronic
1152508500 17:80769713-80769735 CAGCAAGAGGAGGTGGAGAAAGG + Intronic
1203170957 17_GL000205v2_random:147562-147584 CACCAGAAAGCAGTGGGGACTGG - Intergenic
1203191951 17_KI270729v1_random:198984-199006 CGGCAAAAAGCTGTGGCGACGGG - Intergenic
1153209896 18:2750061-2750083 CAGCATAAAACAGATGAGAAAGG + Exonic
1153351812 18:4089668-4089690 CAAAAACAAGCAATGGAGAAAGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154369923 18:13750846-13750868 CAAAAACAAGCAATGGAGAAAGG + Intronic
1154395622 18:13985659-13985681 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1154403886 18:14069856-14069878 CAGAAACAAGCAATGGGGAAAGG + Intronic
1154526439 18:15295052-15295074 CAACAACAAGCAATGGGGAAAGG - Intergenic
1154975432 18:21452819-21452841 CAGAAAAAAGAACAGGAGAAAGG + Intronic
1156008875 18:32473195-32473217 AAACAAAAAGCAGTTGAGAGGGG + Intergenic
1156026415 18:32660081-32660103 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1156083257 18:33366334-33366356 CAGCAACAAGCAAAAGAGAAAGG - Intronic
1156284992 18:35683976-35683998 CAGCAAGAAGTAGAAGAGAATGG + Intronic
1156409002 18:36810125-36810147 CAGCAAAAAGCAGCAGAGTCAGG - Intronic
1156414631 18:36874937-36874959 CAGAAACAAGCAATGGGGAAAGG - Intronic
1156422563 18:36971178-36971200 CTGACAAAAGCAATGGAGAAAGG + Intronic
1156740097 18:40315383-40315405 CAGGAAAGAGCAGTTCAGAAAGG - Intergenic
1156771108 18:40727137-40727159 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1156847920 18:41690664-41690686 CTCTAAAATGCAGTGGAGAAAGG - Intergenic
1156884958 18:42124383-42124405 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1156931732 18:42652968-42652990 CAACAATAAGCAATGGGGAAAGG + Intergenic
1156972275 18:43170791-43170813 CAGCAGAAAGCAGTTAAGACTGG + Intergenic
1157054582 18:44211508-44211530 CAGAAACAAGCAGTGGGGAAAGG + Intergenic
1157060003 18:44277135-44277157 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1157073721 18:44440873-44440895 CAACAACAAGCAATGGGGAAAGG + Intergenic
1157178393 18:45473136-45473158 CAAAAACAAGCAATGGAGAAAGG - Intronic
1157206534 18:45705051-45705073 CAGAAACAAGAAATGGAGAAAGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157475244 18:48019847-48019869 CTGCACAAAGGAGTGTAGAATGG + Intergenic
1157523120 18:48358991-48359013 CAGCAGGAAGCATTGGAGACAGG - Intronic
1157817830 18:50743041-50743063 AAGCAAAAAGCAGAGGGTAAAGG - Intergenic
1157854659 18:51094075-51094097 CAGAAAGAAGCAATGGGGAAAGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158143978 18:54289709-54289731 CAGAAACAAGCAATGGGGAAAGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158209257 18:55028135-55028157 CAAAAGCAAGCAGTGGAGAAAGG + Intergenic
1158262019 18:55617199-55617221 CAACAAAACACAGTGGGGAAAGG - Intronic
1158330807 18:56359912-56359934 CAGCGAAGGGAAGTGGAGAAGGG - Intergenic
1158574274 18:58623087-58623109 CAGAAAAAAGCAGTGGTGTGAGG + Intronic
1158792473 18:60798431-60798453 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1158841002 18:61387289-61387311 CTACCAAAAGAAGTGGAGAATGG + Intronic
1159111365 18:64060235-64060257 CAACAACAAGCAATGGAGAAAGG - Intergenic
1159157627 18:64605054-64605076 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1159216815 18:65402755-65402777 CAGAAAAAAGTAGAAGAGAAGGG + Intergenic
1159431826 18:68362453-68362475 CAGCAAAAAGTAGTTAAGATCGG + Intergenic
1159571516 18:70119455-70119477 AAGGAAAAAGCAAAGGAGAAAGG + Intronic
1162302850 19:9854058-9854080 CAGCAAAAAGGCGGGGAGAAAGG + Exonic
1163177540 19:15575027-15575049 GAGCTAAAAGTGGTGGAGAAGGG + Intergenic
1163894815 19:20049452-20049474 CAGGAAAAACTAGTGGAGGATGG + Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164509503 19:28885847-28885869 AAGCAAATGGCAGTGGAGAAGGG - Intergenic
1164933461 19:32193313-32193335 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1164934381 19:32199784-32199806 CAGCACAAGCCAGTGGAGATGGG + Intergenic
1166157848 19:40928115-40928137 CAGCAAGAAACAGGGAAGAAAGG + Intergenic
1166263887 19:41664460-41664482 CAAAAACAAGAAGTGGAGAAAGG + Intronic
1166392789 19:42419343-42419365 CTGCACAAAGGAGTGGGGAAGGG + Intronic
1167374783 19:49104795-49104817 AAGCAGAAAGCAGCAGAGAAGGG - Intronic
1167606255 19:50482399-50482421 CAGCAGAAGGCAGAGGACAAGGG - Exonic
1167717032 19:51149412-51149434 CAAAAAAAAGCAATGGGGAAAGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168285806 19:55332281-55332303 AAAAAAAAAGAAGTGGAGAATGG + Intronic
1168301411 19:55407271-55407293 AACCAAAAATTAGTGGAGAAGGG - Intronic
1168460543 19:56552868-56552890 CAGCAAAATACAGAAGAGAAAGG - Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925042690 2:745370-745392 CAAAAACAAGCAATGGAGAAAGG - Intergenic
925049201 2:798044-798066 CAGCAGAGAGCGGTGGAGAGAGG - Intergenic
925239832 2:2314908-2314930 CAAAAACAAGCAATGGAGAAAGG + Intronic
925252343 2:2450792-2450814 GAGCAAAAATCAGTGCAAAAAGG - Intergenic
925255309 2:2480522-2480544 CAGGAAATCTCAGTGGAGAAGGG - Intergenic
925577797 2:5378608-5378630 CAACAAGAAGCAATGGGGAAAGG + Intergenic
925826038 2:7849546-7849568 CAGCATAAAGCTGGGGAGAGAGG - Intergenic
925973220 2:9122261-9122283 CAGCAAAAAGGAGGTGAGAGAGG + Intergenic
926474965 2:13310239-13310261 CAAAAACAAGCAATGGAGAAAGG - Intergenic
926642274 2:15250194-15250216 CAGAAACAAGCAATGGGGAAAGG + Intronic
926876813 2:17489687-17489709 CAAAAACAAGCAATGGAGAAAGG - Intergenic
927218258 2:20682377-20682399 CAGCATGATGCAGTGGAAAAAGG + Intergenic
927237875 2:20893237-20893259 CAAAAAAAAGCAATGGGGAAAGG + Intergenic
928083554 2:28331053-28331075 CAAAAACAAGCAGTGGGGAAAGG + Intronic
928243179 2:29604359-29604381 CAGAAAAAAGAAGCAGAGAAGGG + Intronic
928386698 2:30875189-30875211 CAAAAACAAGCAGTGGAGAAAGG - Intergenic
928694597 2:33836530-33836552 CAGAAGAAAGATGTGGAGAATGG - Intergenic
928931982 2:36634473-36634495 CAAAAATAAGCAATGGAGAAAGG - Intronic
929079960 2:38112455-38112477 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
929213932 2:39390585-39390607 CAGCAAGAGGCACTGGAGGAAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929740514 2:44594543-44594565 CAGAAACAAGCAATGGGGAAAGG + Intronic
929907439 2:46058503-46058525 GAGAAACAGGCAGTGGAGAAGGG + Intronic
930259938 2:49133800-49133822 CAAAAAAAAGCAATGGGGAAAGG + Intronic
930398337 2:50850304-50850326 TGTTAAAAAGCAGTGGAGAAGGG - Intronic
930556844 2:52907088-52907110 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
930673256 2:54173798-54173820 CAGAAACAAGCAATGGGGAAAGG - Intronic
930772302 2:55140549-55140571 AAGCAAAAAGAAGTGGGGAGAGG + Intergenic
930987355 2:57606664-57606686 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931328680 2:61255951-61255973 CAGCAAAAAGCAGTATATATAGG + Intronic
931502864 2:62889656-62889678 CAAAAATAAGCAATGGAGAAAGG - Intronic
931792677 2:65678935-65678957 CAGCCAAAAGCAGGGGAGTCCGG - Intergenic
932017612 2:68048350-68048372 CAGCAAATAGCATTGCAGAATGG + Intronic
932033395 2:68214025-68214047 CAAAAACAAGCAGTGCAGAAAGG + Intronic
932045841 2:68348856-68348878 CAAAAACAAGCAATGGAGAAAGG + Intergenic
932608376 2:73179320-73179342 CAGCAAATAGGACTGGAGAGGGG + Intergenic
932646260 2:73506051-73506073 CTGACAAAAGCAATGGAGAAAGG - Intronic
932816576 2:74866589-74866611 CAGGAAACAGCAGTGTAGACAGG - Intronic
932847308 2:75148981-75149003 CAAAAACAAGCAATGGAGAAAGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933005813 2:76993004-76993026 CCGAAATAAGCAGTGGGGAAAGG + Intronic
933039389 2:77443364-77443386 CAGCAAAAAGCAGTGGCACCAGG + Intronic
933118588 2:78505605-78505627 CATAAACAAGCAGTGGAGAAAGG + Intergenic
933200573 2:79443389-79443411 CAGAAAAAAAAAGTGGAGGAAGG - Intronic
933515164 2:83291205-83291227 AGGGAAAAATCAGTGGAGAAGGG - Intergenic
933521756 2:83382688-83382710 CAACAACAAGCAATGGAGAAAGG + Intergenic
933938207 2:87224107-87224129 CATCCAAATGCAGTGGTGAAGGG - Intergenic
934793143 2:97080346-97080368 CAAAAACAAGCAATGGAGAAAGG - Intergenic
934813043 2:97300197-97300219 CAAAAACAAGCAATGGAGAAAGG + Intergenic
934824652 2:97408283-97408305 CAAAAACAAGCAATGGAGAAAGG - Intergenic
935004142 2:99054257-99054279 CAAGAAGATGCAGTGGAGAAAGG + Intronic
935060539 2:99603362-99603384 CAGAAACAAGCAATGGGGAAAGG + Intronic
935338633 2:102039789-102039811 CAAAAACAAGCAATGGAGAAAGG - Intergenic
935567513 2:104624992-104625014 CAAAAACAAGCAATGGAGAAAGG - Intergenic
935611280 2:105028215-105028237 CAAAAATAAGCAATGGAGAAAGG + Intergenic
935641249 2:105292552-105292574 CATCAAAAGGCAGAGAAGAAGGG + Intronic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936354929 2:111741668-111741690 CATCCAAATGCAGTGGTGAAGGG + Intergenic
936394480 2:112111391-112111413 CAGAAAAAAATAGTAGAGAATGG - Intronic
936784315 2:116074964-116074986 CAAAAACAAGCAATGGAGAAAGG - Intergenic
937076006 2:119107288-119107310 CAGCATAAAGCTGTGCATAAAGG - Intergenic
937076085 2:119107939-119107961 CAGAAAGTGGCAGTGGAGAAAGG + Intergenic
937196288 2:120159784-120159806 CAGAAACAAGCAATGGAGAAAGG + Intronic
937488154 2:122337602-122337624 AAGCAAAAAGAAGTGTAAAAAGG - Intergenic
937498649 2:122453015-122453037 CAAAAATAAGCACTGGAGAAAGG + Intergenic
937612678 2:123881014-123881036 CAACACACAGCAGTGCAGAAAGG - Intergenic
937991736 2:127666213-127666235 CAGCAGAAAGTGGTGGAGTAAGG + Intronic
938032558 2:128008054-128008076 CAGCTAAAAGCAGGGCAGAGTGG - Intronic
938145280 2:128829574-128829596 CAAAAACAAGCAATGGAGAAAGG + Intergenic
938262608 2:129906332-129906354 CAGCAAACAGCACAGGAGAGCGG - Intergenic
938567041 2:132528189-132528211 CAAAAACAAGCAATGGAGAAAGG - Intronic
938685838 2:133736889-133736911 AAACAAAAAGAAGAGGAGAAGGG + Intergenic
938757104 2:134391136-134391158 CAGCAATAAGCAGAGGATTAGGG + Intronic
938916499 2:135946485-135946507 AAGAAAAAAGCAGGGAAGAAAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939205111 2:139092129-139092151 CAATAACAAGCAATGGAGAAAGG + Intergenic
939398779 2:141665087-141665109 CAGAAACAAGCAATGGGGAAAGG + Intronic
939660640 2:144884774-144884796 CATCCCAAATCAGTGGAGAAAGG - Intergenic
939809407 2:146812751-146812773 CAGAAACAAGCAATGGAGAAAGG + Intergenic
939860229 2:147411215-147411237 CAAAAATAAGCAGTGAAGAAAGG - Intergenic
940021036 2:149156145-149156167 CAGCACAGAGCATTTGAGAAGGG + Intronic
940054841 2:149502488-149502510 CAGAAACAAGCAATGGGGAAAGG - Intergenic
940086536 2:149865519-149865541 CAAAAACAAGCAATGGAGAAAGG + Intergenic
941112867 2:161435827-161435849 CAACAACAAGCAATGCAGAAAGG - Intronic
941135775 2:161716565-161716587 CAAAAACAAGCAATGGAGAAAGG - Intronic
941199971 2:162496165-162496187 CAGCAGGAAGCAGTTTAGAATGG + Intronic
942179486 2:173366495-173366517 CAGAAAAAGGCATTGGTGAAGGG + Intronic
942350680 2:175049837-175049859 CAGCAAGATGAAGGGGAGAAGGG + Intergenic
942356512 2:175118602-175118624 CAGAAAGAAGCAGTGGACTAAGG - Intronic
942411641 2:175715552-175715574 CAGCTAAAGCCAGTGGAAAAAGG + Intergenic
942638624 2:178036753-178036775 CAAAAACAAGCAGTGGAGAAAGG + Intronic
942669314 2:178356970-178356992 CAAAAACAAGCAATGGAGAAAGG + Intronic
942732705 2:179076945-179076967 GAGGAAAAAACAGTGCAGAAAGG + Intergenic
942833643 2:180266106-180266128 GAGAAGAAAACAGTGGAGAATGG + Intergenic
942843114 2:180388513-180388535 CAAAAACAAGCAATGGAGAAAGG - Intergenic
943028865 2:182662570-182662592 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
943073375 2:183167871-183167893 CAGAAATAAGCAATGGGGAAAGG - Intergenic
943095307 2:183421306-183421328 CTGACAAAAGCAATGGAGAAAGG + Intergenic
943164799 2:184307440-184307462 CAAAAATAAGCAATGGAGAAAGG - Intergenic
943246280 2:185455621-185455643 CAGAAAGAATCAGTTGAGAAAGG - Intergenic
943262468 2:185683628-185683650 CAAAAACAAGCAATGGAGAAAGG - Intergenic
943273147 2:185833333-185833355 AAGCAAAAGGAAGTGTAGAAGGG + Intergenic
943391531 2:187275230-187275252 CAAAAATAAGCAATGGAGAAAGG - Intergenic
943721904 2:191213442-191213464 TAGGAAAAAGCAGTGGATTAAGG - Intergenic
944085702 2:195845740-195845762 CAAAAATAAGCAATGGAGAAAGG + Intronic
944092591 2:195929604-195929626 CAAAAATAAGCAATGGAGAAAGG + Intronic
944157874 2:196626872-196626894 TAGCGAACAGCAGTGGAAAATGG - Intergenic
944200704 2:197104480-197104502 CAGCAAAAAACTTTTGAGAAAGG + Intronic
944254361 2:197609877-197609899 CAAAAACAAGCAGTGGGGAAAGG - Intronic
944299359 2:198105275-198105297 CAACAACAAGCAATAGAGAAAGG - Intronic
945326621 2:208489504-208489526 GAGCAAAAAGGAGTGGGGAGGGG + Intronic
945455412 2:210046647-210046669 CAGCCAATAGCTGTGGAGATGGG - Intronic
945487415 2:210413397-210413419 CAACTACAAGCAATGGAGAAAGG - Intergenic
945516714 2:210771601-210771623 CAAAAAAAAGCAATGGGGAAAGG + Intergenic
945574054 2:211507865-211507887 CAAAAACAAGCAATGGAGAAAGG + Intronic
945579753 2:211578685-211578707 CAACAAGAAGCAATGGGGAAAGG + Intronic
945787033 2:214253563-214253585 CAGAAACAAGCAATGGGGAAAGG - Intronic
946002722 2:216496328-216496350 AAGCAAAAAGTAGTGGATAGTGG - Intergenic
946064864 2:216977978-216978000 CAAAAACAAGCAATGGAGAAAGG - Intergenic
947086463 2:226458588-226458610 CAGAAACAAGCAACGGAGAAAGG + Intergenic
947338120 2:229108419-229108441 CTGCACAAAGCAGAGGAGAGAGG + Intronic
947957845 2:234209864-234209886 CAAAAACAAGCAGTGGAGACAGG - Intergenic
948418904 2:237840299-237840321 CAAAAACAAGCAATGGAGAAAGG + Intronic
1169394797 20:5219943-5219965 CTGCTACAAGCAGTGGAGACAGG - Intergenic
1170227569 20:14008852-14008874 CACAAACAAGCAATGGAGAAAGG + Intronic
1170239373 20:14146432-14146454 AAGCAGCAACCAGTGGAGAAGGG - Intronic
1170486813 20:16826219-16826241 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1170490841 20:16872526-16872548 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1170720035 20:18868685-18868707 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1170762430 20:19262657-19262679 CAGCAGAAAGTTATGGAGAAAGG - Intronic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171913545 20:30990192-30990214 GAAAAACAAGCAGTGGAGAAAGG + Intergenic
1172207102 20:33170992-33171014 CAAAAACAAGCAGTGGGGAAAGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1172991646 20:39041117-39041139 CAGGACAAAACAGTGGAGATGGG - Intergenic
1173121202 20:40291126-40291148 CAATAAAAAGAAGTGGAGTATGG - Intergenic
1173294250 20:41741797-41741819 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1173394782 20:42669182-42669204 CCTCAAAAAGATGTGGAGAAAGG - Intronic
1173916679 20:46713285-46713307 CAGAAAAAACAAGTGGAGAAGGG + Intronic
1174667735 20:52275693-52275715 AAGAGAAAAGCAGTGGAGCAGGG - Intergenic
1175351402 20:58322718-58322740 CAGCACAAAGCCTGGGAGAAGGG - Intronic
1175460666 20:59149800-59149822 CAGAAAAAGGCAGTGGAGACTGG - Intergenic
1175680319 20:60983236-60983258 CAGAAACAAGCAATGGGGAAAGG - Intergenic
1176326941 21:5509393-5509415 CACCAGAAAGCAGTGGGGACTGG - Intergenic
1176330765 21:5546818-5546840 CACCAGAAAGCAGTGGGGACTGG + Intergenic
1176396992 21:6274133-6274155 CACCAGAAAGCAGTGGGGACTGG - Intergenic
1176400816 21:6311558-6311580 CACCAGAAAGCAGTGGGGACTGG + Intergenic
1176436341 21:6677546-6677568 CACCAGAAAGCAGTGGGGACTGG - Intergenic
1176440165 21:6714971-6714993 CACCAGAAAGCAGTGGGGACTGG + Intergenic
1176460603 21:7004616-7004638 CACCAGAAAGCAGTGGGGACTGG - Intergenic
1176464427 21:7042040-7042062 CACCAGAAAGCAGTGGGGACTGG + Intergenic
1176484164 21:7386394-7386416 CACCAGAAAGCAGTGGGGACTGG - Intergenic
1176487988 21:7423819-7423841 CACCAGAAAGCAGTGGGGACTGG + Intergenic
1176716148 21:10350928-10350950 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1177025048 21:15912506-15912528 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1177073630 21:16544053-16544075 CACCAAAATGGAGTGGTGAATGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1177949858 21:27521527-27521549 CAAAAAAAAGCAATGGGGAAAGG - Intergenic
1178026253 21:28471621-28471643 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1178604313 21:34022235-34022257 TAAAAAAAATCAGTGGAGAATGG + Intergenic
1178811306 21:35884536-35884558 CAGAAACAAGCAATGGGGAAAGG + Intronic
1178813109 21:35902611-35902633 CAAAAACAAGCAGTGGGGAAAGG + Intronic
1179031354 21:37722668-37722690 CAAAAATAAGCAGTGGGGAAAGG + Intronic
1179047122 21:37855968-37855990 CAGCAGAAGGCAGGGGAGAGGGG + Intronic
1179262315 21:39768723-39768745 ATGCAACAAGGAGTGGAGAAAGG - Intronic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1180128422 21:45807928-45807950 CAAAAACAAGCAGTGGGGAAAGG + Intronic
1180281316 22:10699138-10699160 CAGCAAAAAGCCGCTGAGACGGG - Intergenic
1180281447 22:10699711-10699733 CAGCAAAAAGCCGCTGAGACGGG - Intergenic
1180929561 22:19579563-19579585 CTCCAAAGAGCAGTGGAGACTGG - Intergenic
1182204965 22:28614675-28614697 CAGCAACAAGCAATGGGGGAAGG + Intronic
1182310252 22:29399664-29399686 CTTCAAAAAGCAGAGGAGCAGGG - Intronic
1182711106 22:32323867-32323889 CAGCAAAAAGGAGTGAGGAGGGG - Intergenic
1183242951 22:36671984-36672006 CAGCAAAAGGCAATAAAGAAAGG + Intronic
1183371894 22:37437434-37437456 CAGCCAAGAGGAGTGGGGAAAGG + Intergenic
1184398633 22:44260740-44260762 CAGCAAAAAGGAGTGAGGAGGGG - Intronic
1184650416 22:45917047-45917069 CAGCAAAATGCAAAGGAGAGGGG - Intergenic
1184822697 22:46922144-46922166 CAAAAACAAGCAATGGAGAAAGG - Intronic
1203238543 22_KI270732v1_random:31200-31222 CAGCAAAAAGCCGCTGAGACGGG - Intergenic
1203238594 22_KI270732v1_random:31418-31440 CAGCAAAAAGCCGCTGAGACGGG - Intergenic
1203238706 22_KI270732v1_random:31898-31920 CAGCAAAAAGCCGCTGAGACGGG - Intergenic
949246996 3:1936954-1936976 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
949273885 3:2255145-2255167 CAAAAACAAGCAATGGAGAAAGG - Intronic
949565854 3:5244009-5244031 CAAAAATAAGCAGTGGGGAAAGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950031265 3:9855439-9855461 CAGAAAAGTGCAGAGGAGAAAGG + Intergenic
950074837 3:10180154-10180176 CAGCAGAAGGCAGTGGGGATGGG + Intronic
950647278 3:14384606-14384628 AAGAAAAAGGAAGTGGAGAAAGG - Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951275635 3:20682183-20682205 CAAAAACAAGCAATGGAGAAAGG + Intergenic
951468664 3:23031677-23031699 CAGAAATAAGCAATGGGGAAAGG - Intergenic
951906701 3:27714014-27714036 CAGGAAAAAGCAGTGCAAAGAGG - Intergenic
952290092 3:32006682-32006704 CACCACAAGTCAGTGGAGAAAGG - Intronic
952546596 3:34426736-34426758 CAAAAACAAGCAGTGGAAAAAGG + Intergenic
952560586 3:34588364-34588386 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
952695699 3:36263265-36263287 CAGAAACAAGCAATGCAGAAAGG - Intergenic
953155685 3:40370617-40370639 CAAAAATAAGCAATGGAGAAAGG + Intergenic
953261554 3:41344207-41344229 CAAAAACAAGCAGTGGGGAAAGG + Intronic
953573800 3:44096555-44096577 TTGCACAAAGCAGAGGAGAAGGG - Intergenic
953756559 3:45651589-45651611 CAAAAACAAGCAATGGAGAAAGG - Intronic
954130958 3:48560771-48560793 CAGCAAAGAGCAGAGCAGGAGGG + Intronic
954553571 3:51501742-51501764 CAGGAGAAAGAAGTGAAGAAAGG - Intergenic
954569664 3:51630084-51630106 AAGGAAAAACCAGTAGAGAAAGG + Intronic
954836064 3:53469221-53469243 CAGAAACAAGAAATGGAGAAAGG - Intergenic
955603080 3:60668933-60668955 CAGGAAAAAGCAGGGGAAAATGG + Intronic
956156886 3:66307759-66307781 CAAAAACAAGCAGTGGGGAAAGG - Intronic
956397653 3:68842803-68842825 CAAAAATAAGCAGTGGGGAAAGG - Intronic
956457049 3:69432077-69432099 TATAAAAAAGCAGTGGAAAATGG + Intronic
956863122 3:73343997-73344019 AAGCAGAAAGCAATGGAGTAAGG - Intergenic
956994920 3:74815041-74815063 CAGGAAAAAGCAGGGCAGAGGGG - Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957080406 3:75631812-75631834 CACCAGAAAGCAGTGGGGACTGG + Intergenic
957188848 3:76980157-76980179 AAACAAAAAGCAGCCGAGAATGG - Intronic
957211012 3:77258671-77258693 CAGCAAAAGGAAGTGTTGAAAGG - Intronic
957486842 3:80872294-80872316 CAAAAATAAGCAATGGAGAATGG + Intergenic
957575861 3:82007503-82007525 CAGAAACAAGCAATAGAGAAAGG - Intergenic
957580168 3:82061726-82061748 CAAAAATAAGCAATGGAGAAAGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
957992184 3:87640257-87640279 CAAAAATAAGCAATGGAGAAAGG - Intergenic
958021973 3:88008562-88008584 CAAAAATAAGCAATGGAGAAAGG + Intergenic
958148632 3:89660013-89660035 CACTAAAAAGCAATGCAGAAAGG - Intergenic
958460258 3:94385491-94385513 CAGAAACAAGCAATGGGGAAAGG + Intergenic
958482275 3:94657812-94657834 CAGCACAAAGCAGTCAACAATGG - Intergenic
958591188 3:96160138-96160160 CAAAAACAAGCAATGGAGAAAGG + Intergenic
958635458 3:96738833-96738855 CAAAAACAAGCAATGGAGAAAGG + Intergenic
958684129 3:97371028-97371050 CAGCAAAATTCAGTGCAGATAGG - Intronic
958747879 3:98159452-98159474 CAAAAACAAGCAGTAGAGAATGG + Intergenic
958881837 3:99680870-99680892 CAGAAACAAGAAATGGAGAAAGG + Intronic
958952759 3:100434325-100434347 CAGAAACAAGCAATGGGGAAAGG - Intronic
959316416 3:104813509-104813531 CAAAAATAAGCAGTGGGGAAAGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960011188 3:112835742-112835764 CACCAATAAGCATGGGAGAAAGG - Intronic
960019929 3:112937450-112937472 CAGAAACAAGCAATGGGGAAAGG - Intronic
960043168 3:113170671-113170693 CAGCAAAAAGAAAAGCAGAATGG + Intergenic
960306923 3:116073166-116073188 CAAAAACAAGCAATGGAGAAAGG - Intronic
960630254 3:119723174-119723196 CTGCAAAAAGCAGCTGAGATTGG + Intronic
961403019 3:126660448-126660470 CACTAGAAAGCAGTGGACAAGGG - Intergenic
961633613 3:128319138-128319160 CAGAAAAACACAGTGGGGAAAGG - Intronic
961783410 3:129335071-129335093 CAGAAAAGTGCAGAGGAGAAAGG + Intergenic
962122114 3:132572770-132572792 CAAAAACAAGCAATGGAGAAAGG + Intronic
962242318 3:133760247-133760269 CAGCAAAAATCTGTTGACAATGG - Intronic
962694675 3:137936267-137936289 CAAAAACAAGCAATGGAGAAAGG - Intergenic
962700109 3:137989438-137989460 GAGCAAAAAGAAGAGAAGAAAGG - Intergenic
962833726 3:139167729-139167751 CAAAAAAAAGAAATGGAGAAAGG - Intronic
962981568 3:140495723-140495745 CAGAAATAAGCAATGGGGAAAGG - Intronic
963638871 3:147834668-147834690 CAAAAATAAGCAATGGAGAAAGG - Intergenic
963692075 3:148517662-148517684 CAAAAACAAGCACTGGAGAAAGG - Intergenic
964106514 3:153046308-153046330 AAACCAAAAGCAGTGGACAAAGG - Intergenic
964128799 3:153264895-153264917 CAAAAACAAGCAATGGAGAAAGG + Intergenic
964410030 3:156388405-156388427 GAGCAAAAAGCAGTATAGCAAGG + Intronic
964416833 3:156456725-156456747 CCATAAACAGCAGTGGAGAAGGG - Intronic
964502775 3:157366796-157366818 TAGGAAAAAGCAATGCAGAAGGG + Intronic
964533169 3:157690066-157690088 CAGGAACAAGCAATGGGGAAAGG + Intergenic
964550968 3:157884221-157884243 CAGAAACAAGCAATGGGGAAAGG + Intergenic
964561662 3:158003718-158003740 CAAAAACAAGCAATGGAGAAAGG + Intergenic
964828358 3:160855106-160855128 CAAAAACAAGCAATGGAGAAAGG + Intronic
964930981 3:162022377-162022399 CAGCAAAGAGCTGTTGAAAATGG - Intergenic
965022556 3:163252274-163252296 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
965035617 3:163433954-163433976 GAAAAAAAAGCAATGGAGAAAGG + Intergenic
965128932 3:164669592-164669614 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
965159608 3:165115404-165115426 CAAAAACAAGCAATGGAGAAAGG - Intergenic
965292757 3:166905001-166905023 CAAAAACAAGCAATGGAGAAAGG - Intergenic
966049402 3:175595256-175595278 CAAAAACAAGCAATGGAGAAAGG - Intronic
966561335 3:181324338-181324360 GAGGAAAAAGCAGTGCAAAAAGG - Intergenic
966566825 3:181392043-181392065 CAAAAACAAGCAATGGAGAAAGG - Intergenic
967013802 3:185463755-185463777 CAATAAAAAGCAGAGGTGAAAGG - Intronic
967059599 3:185860297-185860319 CAAAAATAAGCAATGGAGAAAGG + Intergenic
967118588 3:186362907-186362929 CACCTAAAAGCAAAGGAGAATGG - Intergenic
967181052 3:186904788-186904810 CAAAAACAAGCAATGGAGAAAGG - Intergenic
967563088 3:190940034-190940056 CAACAAAAAACAGTGCTGAAAGG - Intergenic
967767309 3:193295389-193295411 GAGGAGATAGCAGTGGAGAAAGG - Intronic
968074650 3:195809830-195809852 GTGTAAAAAGCAGTGGTGAACGG - Intronic
968195101 3:196699986-196700008 CAGCGCAAAGCAGTGGAGCTTGG - Intronic
968262436 3:197335847-197335869 CAGCAAGAAGAAGGGGAGAGGGG + Intergenic
968377521 4:55211-55233 AAGGAAAAAGCAGAAGAGAAAGG - Intronic
968569737 4:1333346-1333368 AAAAAAAAAGCAGTTGAGAAAGG + Intronic
968696031 4:2027771-2027793 CAGAAATAAGCAATGGGGAAAGG - Intronic
968844530 4:3032901-3032923 CAGCACAGAGCAGAGGAGAGGGG - Intronic
969076940 4:4587097-4587119 CAAAAACAAGCAATGGAGAAAGG + Intergenic
969137996 4:5046247-5046269 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969166733 4:5322582-5322604 CAGGAAGAAGAAGTGGAGAAAGG + Intronic
969519087 4:7665384-7665406 CAGCAGAGAGCAGTGGAGACTGG - Intronic
969852809 4:9974986-9975008 CAGAAATAAGCAATGGGGAAAGG + Intronic
969953988 4:10869141-10869163 CAAAAATAAGCAATGGAGAAAGG - Intergenic
969990382 4:11256103-11256125 GTGCAAAAAGAAGTAGAGAAAGG - Intergenic
970082941 4:12309327-12309349 CAAAAACAAGCAATGGAGAAAGG - Intergenic
970250779 4:14113455-14113477 CAGCAAGAAGCATGGGAGGAAGG - Intergenic
970306426 4:14737223-14737245 CAGAAACAAGCAATAGAGAAAGG + Intergenic
970470024 4:16368549-16368571 CAGAAACAAGCAATGGGGAAAGG - Intergenic
970550581 4:17177089-17177111 CACCAAAAATCATTGGAGTAGGG + Intergenic
970642863 4:18086999-18087021 CAAAAACAAGCAATGGAGAAAGG + Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
970862244 4:20717593-20717615 CAGAAACAAGCAATGGGGAAAGG - Intronic
970864545 4:20743501-20743523 CAGAAACAAGCAATGGGGAAAGG + Intronic
970884124 4:20967661-20967683 CAGAAACAAGCAATGGGGAAGGG + Intronic
970909172 4:21254638-21254660 CAGCATTAAGCAGTGGAGGTAGG - Intronic
971343780 4:25793906-25793928 CAAAAACAAGCAATGGAGAAAGG + Intronic
971648119 4:29234522-29234544 CAAAAACAAGCAATGGAGAAAGG + Intergenic
971679450 4:29677786-29677808 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
971772084 4:30910057-30910079 CAAAAACAAGCAATGGAGAAAGG + Intronic
972118094 4:35663773-35663795 CAGAAACAAGCAATGGGGAAAGG - Intergenic
972178351 4:36435347-36435369 CAACAACAAGCAATGGGGAAAGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972948713 4:44291368-44291390 CAAAAATAAGCAATGGAGAAAGG + Intronic
973129408 4:46631777-46631799 CAGTAACAAGCAATGGGGAAAGG - Intergenic
973585768 4:52389441-52389463 CAAAAAAAAGCAATGGGGAAAGG - Intergenic
973799712 4:54464995-54465017 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
973867585 4:55129126-55129148 CAGAAACAAGCAATGGGGAAAGG + Intergenic
974234643 4:59165647-59165669 CAGAAATAAGCAATGGGGAAAGG + Intergenic
974263522 4:59555725-59555747 CAGAAACAAGCAATGGGGAAAGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974533602 4:63145646-63145668 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
974603423 4:64119239-64119261 AACAAAAAAGCAATGGAGAATGG - Intergenic
974613952 4:64256940-64256962 CAAAAAAAAGCAAGGGAGAAGGG - Intergenic
974851281 4:67407619-67407641 CAGAAACAAGCAATGGGGAAAGG - Intergenic
974922009 4:68253450-68253472 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
975011837 4:69365101-69365123 CAAAAACAAGCAATGGAGAAAGG - Intronic
975083456 4:70308361-70308383 CAAAAACAAGCAATGGAGAAAGG + Intergenic
975228191 4:71899307-71899329 CAGAAAGAATCAGTCGAGAAAGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975360849 4:73469922-73469944 CAAAAACAAGCAATGGAGAAAGG - Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975449716 4:74510207-74510229 GAAAAACAAGCAGTGGAGAAAGG + Intergenic
975532677 4:75417125-75417147 CAAAAACAAGCAATGGAGAAAGG - Intergenic
975537251 4:75464068-75464090 CAAAAACAAGCAATGGAGAAAGG + Intergenic
975563973 4:75734395-75734417 CAGTAACAAGCAATGGAGAAAGG - Intronic
975619907 4:76286099-76286121 CAGAAACAAGCAATGGGGAAAGG - Intronic
975894604 4:79073770-79073792 CAAAAACAAGCAATGGAGAAAGG + Intergenic
975967409 4:79990841-79990863 CAATAACAAGCAGTGGGGAAAGG + Intronic
976023306 4:80657487-80657509 CAAAAAAAAGCAATGGGGAAAGG - Intronic
976031758 4:80763837-80763859 CAAAAACAAGCAGTGGGGAAAGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977001994 4:91516466-91516488 CAAAAACAAGCAATGGAGAAAGG - Intronic
977039102 4:91992414-91992436 CAGGACAAAGAAGTGGGGAATGG + Intergenic
977129029 4:93210348-93210370 CAACAATAAGCAATGGGGAAAGG - Intronic
977163930 4:93672074-93672096 CAGCAAAAAGAAGGTCAGAAAGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977502293 4:97855925-97855947 CAAAAACAAGCAATGGAGAAAGG - Intronic
977671047 4:99695789-99695811 CAAAAATAAGCAATGGAGAAAGG - Intergenic
977735052 4:100404313-100404335 CAATAACAAGCAGTGGGGAAAGG - Intronic
977971942 4:103223377-103223399 CAGAAACAAGCAGTGTGGAAAGG + Intergenic
977994887 4:103489621-103489643 CAAAAACAAGCAATGGAGAAAGG + Intergenic
978314518 4:107420693-107420715 CAAAAACAAGCAATGGAGAAAGG + Intergenic
978406028 4:108379730-108379752 CATCTAAAAGCAGTGCTGAAGGG + Intergenic
979087659 4:116434139-116434161 CAAAAAAAAGCAATGGGGAAAGG - Intergenic
979130041 4:117032646-117032668 CAAAAACAAGCAATGGAGAAAGG - Intergenic
979373701 4:119919350-119919372 CAAAAACAAGCAATGGAGAAAGG + Intergenic
979398320 4:120217202-120217224 CAAAAACAAGCAATGGAGAAAGG - Intergenic
979748062 4:124242113-124242135 CACAAACAAGCAATGGAGAAAGG + Intergenic
979775920 4:124588333-124588355 CAAAAACAAGCAATGGAGAAAGG + Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980317499 4:131221292-131221314 CAAAAATAAGCAATGGAGAAAGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980454305 4:133019348-133019370 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
980456505 4:133050791-133050813 CAAAAATAAGCAATGGAGAAAGG + Intergenic
980504317 4:133695416-133695438 CAAAAATAAGCAATGGAGAAAGG + Intergenic
980508690 4:133757500-133757522 CAAAAACAAGCAATGGAGAAAGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980555514 4:134398391-134398413 CAAAAACAAGCAATGGAGAAAGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980732760 4:136844036-136844058 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
980786959 4:137568338-137568360 CAAAAAACAGCAATGGAGAAAGG - Intergenic
980797681 4:137706039-137706061 CAGCAAAAGAGGGTGGAGAATGG - Intergenic
980830085 4:138120573-138120595 CCAAAACAAGCAGTGGAGAAAGG + Intergenic
981149109 4:141360908-141360930 CAGAAACAAGCAATGGGGAAAGG + Intergenic
981402280 4:144327347-144327369 CAGTAACAAGCAATGGAGAAAGG + Intergenic
981621586 4:146706197-146706219 CAATAATAAGCAGTGGGGAAAGG - Intergenic
981810308 4:148766661-148766683 CAACAACAAGCAATGGAGAAAGG - Intergenic
982077783 4:151755761-151755783 AAGCAAAAATCAGTGGGAAAAGG - Intronic
982513066 4:156308571-156308593 CATCAAAAAGCAGTTGTGAAAGG - Intergenic
982528717 4:156510771-156510793 CAAAAACAAGCAATGGAGAAAGG + Intergenic
982601439 4:157455709-157455731 CAAAAAAAAGCAATGGAGAAAGG - Intergenic
982638132 4:157922908-157922930 CAAAAACAAGAAGTGGAGAAAGG - Intergenic
982674288 4:158358108-158358130 CAAAAACAAGCAATGGAGAAAGG + Intronic
982725118 4:158898097-158898119 CAAAAACAAGCAGTGGGGAAAGG - Intronic
982788987 4:159568579-159568601 CAAAAACAAGCAATGGAGAAAGG - Intergenic
982847226 4:160269238-160269260 CAGAAACAAGCAATGGGGAAAGG - Intergenic
983036543 4:162873700-162873722 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
983179886 4:164635380-164635402 CAAAAAAAAGCAATGGGGAAAGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983899443 4:173118087-173118109 CAGAAACAAGCAATGGGGAAAGG + Intergenic
983964273 4:173790775-173790797 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
984094708 4:175420356-175420378 CGGCAAAAAGCATAGAAGAAGGG - Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
984301003 4:177917617-177917639 CAGAAACAAGCAATGGGGAAAGG - Intronic
984365393 4:178792990-178793012 GAGCAAAAAGCAGAGGTGGAGGG - Intergenic
984465672 4:180097933-180097955 CAAAAACAAGCAGTGGAAAAAGG - Intergenic
984625689 4:182005328-182005350 CAAAAACAAGCAATGGAGAAAGG - Intergenic
984967696 4:185154944-185154966 CACCAACAAGCAGTGGGAAAAGG + Intergenic
985157307 4:187002838-187002860 CAAAAACAAGCAATGGAGAAAGG - Intergenic
985450513 4:190059403-190059425 CACCAGAAAGCAGTGGGGACTGG - Intergenic
985783126 5:1881225-1881247 GAGGAAAAAGGGGTGGAGAAAGG + Intronic
986195024 5:5530351-5530373 CATAAACAAGCAATGGAGAAAGG - Intergenic
986355637 5:6922596-6922618 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
986358985 5:6957003-6957025 CAACAATAAGCAATGGGGAAAGG + Intergenic
986471068 5:8075685-8075707 CAGAAATAAGCAATGAAGAAAGG + Intergenic
986878216 5:12137064-12137086 CAAAAATAAGCAATGGAGAAAGG + Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
986993858 5:13584037-13584059 CAGTAACAAGCAATGGGGAAAGG - Intergenic
987081142 5:14426702-14426724 CAGCAAGAAGCGGAGGAGATGGG + Intronic
987175783 5:15307286-15307308 CAAAAATAAGCAATGGAGAAAGG - Intergenic
987566025 5:19587550-19587572 CAAAAACAAGCAATGGAGAAAGG - Intronic
987669377 5:20987420-20987442 CAAAAAAAAGCAAAGGAGAAAGG - Intergenic
987688035 5:21230153-21230175 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
988654156 5:33189648-33189670 CACTCAAAAGCAGTGGTGAAAGG - Intergenic
988708385 5:33748227-33748249 CACCAAAAAGCCTTAGAGAAAGG + Intronic
988719641 5:33863936-33863958 GAGAAACAAGCAATGGAGAAAGG + Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
988983497 5:36595105-36595127 GAGTATAAAGCAGTGGAGGAAGG + Intergenic
989083623 5:37652198-37652220 CAGAAACAAGCAATGGGGAAAGG - Intronic
989238209 5:39173701-39173723 CAAAAATAAGCAATGGAGAAAGG - Intronic
989461555 5:41705281-41705303 CAGAAACAAGCAATGGGGAAAGG - Intergenic
989630157 5:43473996-43474018 CAAAAAAAAGCAATGGGGAAAGG + Intronic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
989733304 5:44673246-44673268 CAAAAAAAAGCAATGGGGAAAGG + Intergenic
990007922 5:50964454-50964476 CAGCAAAAGGCAGTGAAGAGAGG + Intergenic
990091634 5:52058312-52058334 CAAAAACAAGCAATGGAGAATGG - Intronic
990163275 5:52967035-52967057 CAAAAACAAGCAATGGAGAAAGG - Intergenic
990195145 5:53306405-53306427 CAAAAACAAGCAATGGAGAAAGG - Intergenic
990231813 5:53720839-53720861 CAGAAACAAGCAATGGGGAAAGG + Intergenic
990659717 5:57999810-57999832 GAGAAAAAAGCAATGGGGAAAGG + Intergenic
990833703 5:59990343-59990365 CAGCATAGAGCTATGGAGAAAGG - Intronic
991224688 5:64256461-64256483 CAGAAACAAGCAATGGGGAAAGG - Intronic
991323666 5:65405405-65405427 CAGAAACAAGCAATGGGGAAAGG - Intronic
991465432 5:66907351-66907373 CAGAAAGAATCAGTGGGGAAAGG + Intronic
991526924 5:67569338-67569360 CAAAAACAAGCAATGGAGAAAGG + Intergenic
991539268 5:67708543-67708565 CAGAAACAAGCAATGGGGAAAGG + Intergenic
991579829 5:68143164-68143186 CAAAAATAAGCAGTGGGGAAAGG + Intergenic
991968706 5:72117619-72117641 CAGGAGAAAGGAGAGGAGAATGG - Intronic
992220713 5:74569602-74569624 CAAAAATAAGCAATGGAGAAAGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992295773 5:75325080-75325102 CAGCAGCAGGCAATGGAGAATGG - Intergenic
992337082 5:75782701-75782723 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
992344295 5:75860817-75860839 CAGAAATAAGCAATGGGGAAAGG + Intergenic
992909156 5:81378217-81378239 CAAAAACAAGCAATGGAGAAAGG + Intronic
993221271 5:85100481-85100503 CAAAAACAAGCAATGGAGAAAGG - Intergenic
993286650 5:86007848-86007870 CAAAAACAAGCAATGGAGAAAGG - Intergenic
993341863 5:86734531-86734553 CAAAAACAAGCAATGGAGAAAGG + Intergenic
993437882 5:87920248-87920270 CAAAAACAAGCAATGGAGAAAGG - Intergenic
993544409 5:89193573-89193595 CAGCAAGAACACGTGGAGAAAGG - Intergenic
993802469 5:92359313-92359335 CAAAAATAAGCACTGGAGAAAGG + Intergenic
993972462 5:94436384-94436406 CTGACAAAAGCAATGGAGAAAGG - Intronic
994004631 5:94823307-94823329 CTGACAAAAGCAGTGGGGAAAGG - Intronic
994060765 5:95474168-95474190 CAAAAATAAGCAATGGAGAAAGG - Intronic
994119550 5:96098582-96098604 CAGAAACAAGCAATGGTGAAAGG - Intergenic
994280081 5:97891245-97891267 CAAAAACAAGCAATGGAGAAAGG - Intergenic
994303852 5:98179283-98179305 CAGAAACAAGCAATGGGGAAAGG + Intergenic
994470028 5:100191827-100191849 CAGAAACAAGCAATGGGGAAAGG - Intergenic
994623264 5:102188354-102188376 CAGAAACAAGCAATGGAGAAAGG - Intergenic
995187265 5:109285033-109285055 CAGCAAAAAGCAGTGCTAGAAGG + Intergenic
995270102 5:110210193-110210215 CAGAAACAAGCAATGGGGAAAGG - Intergenic
995348612 5:111149325-111149347 CACCACAAAACAGTGAAGAAGGG + Intergenic
995419705 5:111950278-111950300 CAGAAACAAGCAATGGGGAAAGG + Intronic
996053570 5:118959826-118959848 CAAAAACAAGCAATGGAGAAAGG + Intronic
996265876 5:121539389-121539411 CAACAACAAGCAATAGAGAAAGG + Intergenic
996385895 5:122910305-122910327 AAACAAAAGGCAGTAGAGAAGGG - Intronic
996456254 5:123686254-123686276 CAAAAATAAGCATTGGAGAAAGG + Intergenic
996955825 5:129182350-129182372 CAGAAACAAGCAATGGGGAAAGG - Intergenic
997564344 5:134875374-134875396 CAGCAGAGAGTTGTGGAGAAGGG + Intronic
997737966 5:136228369-136228391 CAGTAAGGAGCAGGGGAGAAAGG + Intronic
997799806 5:136848969-136848991 CAACAACAAGCAATGGGGAAAGG - Intergenic
997814896 5:137007022-137007044 CAAAAACAAGCAGTGGGGAAAGG + Intronic
998291377 5:140917662-140917684 CAAAAACAAGCAATGGAGAAAGG - Intronic
998315849 5:141182548-141182570 CAAGAAAAAGCAATGGAGATTGG + Exonic
998359371 5:141572031-141572053 CAGCCACAAGCTGTGGATAAAGG + Exonic
998813681 5:145991457-145991479 AAGCAGGAAGCAGTGGAGCAAGG - Intronic
998842420 5:146269139-146269161 CAGAAAAAATGAGTTGAGAATGG + Intronic
999593584 5:153176749-153176771 CAAAAACAAGCAATGGAGAAAGG + Intergenic
999665769 5:153911270-153911292 TAGTAAAATGGAGTGGAGAAGGG - Intergenic
999918060 5:156285555-156285577 CAAAAACAAGCAATGGAGAAAGG + Intronic
999967790 5:156828323-156828345 CAGAAATAAGCAATGGGGAAAGG + Intergenic
1000375693 5:160579426-160579448 CAGAAACAAGCAATGGGGAAAGG - Intronic
1000534498 5:162463159-162463181 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1000720288 5:164697627-164697649 AAAAAAAAAGCAATGGAGAAAGG + Intergenic
1000776585 5:165427149-165427171 CAGCAGTGAGCAATGGAGAATGG + Intergenic
1001403658 5:171461181-171461203 CAGCAGAGGGCAGTGGGGAAGGG + Intergenic
1001933812 5:175690934-175690956 CAGCAAAAAGGATGGAAGAAAGG - Intergenic
1002258247 5:177975923-177975945 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1002637410 5:180615207-180615229 CTCCAAAAGGAAGTGGAGAAGGG - Intronic
1002828699 6:798525-798547 CAGGAAAAATGAATGGAGAAAGG - Intergenic
1003416771 6:5916946-5916968 GAGGAAAAACCAGTGCAGAAAGG - Intergenic
1003423436 6:5978678-5978700 GAGCAAAACTCAGTGGGGAAGGG - Intergenic
1004041658 6:11985107-11985129 AAGGAACAAGCAGTGGAGATTGG - Intergenic
1004208897 6:13617503-13617525 CAGCAAAATGCTGTGGGCAATGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004958351 6:20756298-20756320 CAGTAAAAAGCTGGGGAGAAAGG - Intronic
1004978844 6:20999322-20999344 CAGCATGCAGCAGTGGAGAAGGG + Intronic
1005203679 6:23376458-23376480 CAAAAAAAAGCAATGGAGAAAGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005378726 6:25212097-25212119 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1005653456 6:27907262-27907284 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1005780426 6:29186339-29186361 CAGAAACAAGCAATGGGGAAAGG - Intergenic
1005806899 6:29482185-29482207 CAGAAAAAAGCAATGGGGAAAGG - Intergenic
1006877230 6:37308377-37308399 CAGCAAAAAGCAGTGGAGAAAGG - Intronic
1007226825 6:40321037-40321059 CAGCCACCAGCAGGGGAGAAGGG + Intergenic
1007847313 6:44770315-44770337 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1007917264 6:45573091-45573113 CAGCCAGAAGCAGAGGAGGAAGG - Intronic
1007963221 6:45980159-45980181 CAATAACAAGCAATGGAGAAAGG - Intronic
1007981627 6:46165340-46165362 TAGCAAAAAGTAATGCAGAATGG + Intronic
1007998609 6:46335225-46335247 CAGAAAGAAAAAGTGGAGAAAGG + Intronic
1008060542 6:46992117-46992139 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1008142082 6:47843648-47843670 CAGCAAATCACAGTGGAGAGAGG - Intergenic
1008352791 6:50512933-50512955 ATGGAAAAAGCAGAGGAGAATGG + Intergenic
1008408224 6:51142860-51142882 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1008474258 6:51919388-51919410 CAGAAACAAGCAATGGGGAAAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008801575 6:55374882-55374904 CAAAAACAAGCAGTGGGGAAAGG - Intronic
1008817188 6:55582096-55582118 CACCATAATGCAGTGGGGAAGGG + Intergenic
1008823077 6:55657452-55657474 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1009521850 6:64692749-64692771 CAAAAACAAGCAATGGAGAAAGG - Intronic
1009690110 6:67019390-67019412 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1009729470 6:67581253-67581275 CAAAAATAAGCAATGGAGAAAGG - Intergenic
1010297618 6:74218576-74218598 CAAAAACAAGCAGTGGAGAAAGG - Intergenic
1010343003 6:74779401-74779423 CAACAAAAAGCAATGGAGAGGGG - Intergenic
1010468370 6:76195826-76195848 CAGGAACAGTCAGTGGAGAAAGG - Intergenic
1010662264 6:78584923-78584945 CAGCAAATTACAGTGGAGACTGG + Intergenic
1010676521 6:78752626-78752648 AATTAAAAAGCATTGGAGAATGG + Intergenic
1010783161 6:79969058-79969080 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1010896806 6:81375066-81375088 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1010920872 6:81678960-81678982 CAAAAATAAGCAGTGGGGAAAGG + Intronic
1010994447 6:82517150-82517172 CAAAAAAAAGCAATGGGGAAAGG + Intergenic
1011020207 6:82804490-82804512 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1011072862 6:83404766-83404788 CAAAAACAAGCAATGGAGAAAGG - Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011241822 6:85279799-85279821 CAGGAAAAAACAGGGGAGGAGGG - Intergenic
1011335917 6:86259627-86259649 CAGCAAAAAGGACAGGAGAGGGG - Intergenic
1011463022 6:87625945-87625967 CAAAAACAAGCAATGGAGAAAGG - Intronic
1012228312 6:96730732-96730754 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1012308255 6:97687155-97687177 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1012391620 6:98747407-98747429 CAACAAAAATCAATGGAGAAAGG + Intergenic
1012489660 6:99767588-99767610 CAGAAAAATGCAGTGGTAAAAGG - Intergenic
1012640895 6:101612047-101612069 CAGCAAGAAGCAATACAGAATGG + Intronic
1012825536 6:104141561-104141583 CAAAAAGAAGCAGTGGGGAAAGG - Intergenic
1012964185 6:105655791-105655813 CACTAAAAGGCAGTGGTGAAGGG + Intergenic
1013006813 6:106081522-106081544 CAGGAAAATGAAGTGTAGAAGGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013871356 6:114765326-114765348 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1013875952 6:114828523-114828545 CACCAGAAAGCAGTTGAGAATGG - Intergenic
1013905433 6:115211480-115211502 CAAAAATAAACAGTGGAGAAAGG + Intergenic
1014065096 6:117115436-117115458 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1014065753 6:117123438-117123460 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014409501 6:121096928-121096950 CAAAAACAAGCAGTGGGGAAAGG + Intronic
1014737939 6:125116854-125116876 CAGCTAATAACAGTGGAGATGGG - Intergenic
1014979650 6:127931066-127931088 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1015096139 6:129417071-129417093 CAGCAATGAGCAGGAGAGAAGGG - Intronic
1015307997 6:131732110-131732132 CAGCACAATGCAGTGAATAAAGG + Intronic
1015624020 6:135161069-135161091 CAGCAAGAGGCACTGTAGAAGGG + Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015813147 6:137180967-137180989 CAGCAGAAAGCAGTTAAGATGGG - Intergenic
1016275843 6:142351435-142351457 CAATAACAAGCAATGGAGAAAGG + Intronic
1016399775 6:143667137-143667159 CAAAAACAAGCAATGGAGAAAGG - Intronic
1016565044 6:145442675-145442697 CAGAAACAAGCAATGGGGAAAGG - Intergenic
1016593822 6:145776068-145776090 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1016601916 6:145871928-145871950 CAAAAACAAGCAATGGAGAAAGG + Intronic
1017352119 6:153454675-153454697 CAGGAACAAGCAATGGGGAAAGG - Intergenic
1017384588 6:153868727-153868749 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1018108959 6:160516800-160516822 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1018144225 6:160867894-160867916 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1018175366 6:161173905-161173927 CAAAAACAAGCAGTGGGGAAAGG - Intronic
1018177215 6:161187466-161187488 CAGCAAAAATCAGTTAAGGATGG + Intronic
1018882558 6:167899456-167899478 CAGTTAAAAGCTGTGAAGAATGG - Intronic
1018959335 6:168436121-168436143 CAAAAATAAGCAGTGGAGAAAGG + Intergenic
1019076275 6:169390470-169390492 CAGCAGGAAGCAGTGAAGACTGG - Intergenic
1019135929 6:169907711-169907733 CAGCAGGAAGCAGTGGAGGAAGG + Intergenic
1019641324 7:2105323-2105345 CAGCTAAGAGCAGGGGAGGAAGG + Intronic
1019753374 7:2748391-2748413 CAGAAACAAGCAATGGGGAAAGG + Intronic
1020039299 7:4989100-4989122 CACCAGAAACCAGTGGAAAAAGG + Intronic
1020155999 7:5725379-5725401 CACCAGAAACCAGTGGAAAAAGG - Exonic
1021049113 7:15960503-15960525 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021247136 7:18277357-18277379 CAGCAAAAAGGAGACGAGATGGG + Intronic
1021429229 7:20540691-20540713 CAAAAAAAAGCAATGGGGAAAGG + Intergenic
1021535176 7:21695475-21695497 CAAAAACAAGCAGTGGAGAAAGG + Intronic
1021557236 7:21932533-21932555 CAAAAACAAGCAGTGGGGAAAGG + Intronic
1021588006 7:22230546-22230568 CTGAAGAAGGCAGTGGAGAATGG - Intronic
1021780024 7:24095190-24095212 CAGAAACAAGCAATGGGGAAAGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021935630 7:25628526-25628548 AAGCAAAAAGGAGAGGAGGATGG - Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022984499 7:35637824-35637846 CAGAAACAAGGAGAGGAGAATGG + Intronic
1023024633 7:36039409-36039431 CAGCAGGAAGCAGGGGAGAGCGG - Intergenic
1023191566 7:37588651-37588673 CATCAACAAGCAATGGGGAAAGG + Intergenic
1023348245 7:39293485-39293507 CAACAAAAAGGAATGAAGAAAGG - Intronic
1023348688 7:39297885-39297907 CAAAAACAAGCAATGGAGAAAGG + Intronic
1023382261 7:39621404-39621426 CACCAAAAAGCAGCTGAGACAGG + Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024434583 7:49335835-49335857 AAGCAAAATGCAATAGAGAAAGG - Intergenic
1024470774 7:49767194-49767216 CAGCAGAAAGCAGTGCAGGAAGG - Intergenic
1024868500 7:53933056-53933078 CAATAACAAGCAGTGGGGAAAGG + Intergenic
1024876856 7:54036097-54036119 CAGCAAAACTGAGTGGAGAGTGG + Intergenic
1024907515 7:54404500-54404522 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1024947660 7:54826901-54826923 CAAAAACAAGCAGTGAAGAAAGG + Intergenic
1025075921 7:55943094-55943116 CAGCAAAAAGGAATGTAGGAGGG + Intergenic
1025320207 7:58087328-58087350 CAGCAAAAAGCCGTGGCGGCGGG - Intergenic
1025582507 7:62738042-62738064 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1025847724 7:65215810-65215832 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1025869661 7:65419613-65419635 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1025897973 7:65721679-65721701 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1026373041 7:69720988-69721010 CAGCAAAAAGAAGAAGAGACTGG + Intronic
1026562443 7:71461763-71461785 CAGGAAAAGGCAGAGGAGGAGGG - Intronic
1027442896 7:78239146-78239168 CAGGAAAATACAATGGAGAAAGG + Intronic
1027863877 7:83621723-83621745 CAAAAACAAGCAATGGAGAAAGG + Intronic
1027871395 7:83712661-83712683 CAGAAACAAGCAATGGGGAAAGG - Intergenic
1027877718 7:83792129-83792151 CAACAAAAAGCAATGGACATGGG - Intergenic
1027918465 7:84358396-84358418 CAAAAACAAGCAATGGAGAAAGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028185511 7:87780740-87780762 CAAAAATAAGCAATGGAGAAAGG - Intronic
1028246461 7:88484876-88484898 GAGCAAAAAGAAATGTAGAAAGG - Intergenic
1028257847 7:88622659-88622681 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1028384316 7:90237201-90237223 CAGGAAAAAGCAGTGGAAGTAGG - Exonic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028814490 7:95129109-95129131 CAAAAATAAGCAATGGAGAAAGG - Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029004235 7:97190823-97190845 CAGAAGCAAGCAATGGAGAAAGG + Intergenic
1029068894 7:97879027-97879049 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1029310118 7:99655338-99655360 CAAAAACAAGCAGTGGGGAAAGG - Intronic
1030012101 7:105180307-105180329 CAGAAACAAGCAATGGGGAATGG + Intronic
1030059565 7:105612030-105612052 CAGCCAGAAGCGGTGGTGAAAGG - Intronic
1030184949 7:106752439-106752461 CTGCTACAAGCAGTGGAGATAGG - Intergenic
1030458217 7:109799854-109799876 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1030732581 7:113007423-113007445 CAACAACAAGCAATGGGGAAAGG - Intergenic
1031039357 7:116822642-116822664 AAGCAACAAGCAATGGGGAAAGG - Intronic
1031238079 7:119201992-119202014 CAAAAATAAACAGTGGAGAATGG + Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031530864 7:122874763-122874785 CAAAAACAAGCAATGGAGAAAGG + Intronic
1031543976 7:123030101-123030123 CAGTATAAAGTAGTGAAGAATGG - Intergenic
1031736159 7:125364707-125364729 CAGAAATAAGCAATGGGGAAGGG - Intergenic
1031784344 7:126010008-126010030 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1032832043 7:135637838-135637860 AAGAAAAACTCAGTGGAGAATGG - Intronic
1032857701 7:135849305-135849327 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1032914558 7:136475001-136475023 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1033300597 7:140181219-140181241 AAGAAAAATGAAGTGGAGAATGG - Intergenic
1033411006 7:141117769-141117791 CAAAAACAAGCAATGGAGAAAGG - Intronic
1033518560 7:142135426-142135448 AAGAAAAAAACAGGGGAGAAAGG - Intronic
1033819060 7:145111372-145111394 ACAAAAAAAGCAGTGGAGAAAGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034705656 7:153140749-153140771 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034742315 7:153488095-153488117 CAAAAACAAGCAATGGAGAATGG - Intergenic
1034749237 7:153553398-153553420 CAGAGAAAGGAAGTGGAGAAAGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035672553 8:1431486-1431508 CAGCAGAAAGAAGAAGAGAAAGG + Intergenic
1035674360 8:1444700-1444722 CAGGAGTAAGCAGGGGAGAAAGG - Intergenic
1036139689 8:6195959-6195981 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1036804077 8:11816127-11816149 CAAAAACAAGCAATGGAGAAAGG - Intronic
1036908038 8:12724320-12724342 CAGTCTACAGCAGTGGAGAAAGG - Intronic
1037111580 8:15169184-15169206 CAGCAAGAAGCAGTTAAGATTGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037340736 8:17841778-17841800 CAACAAAAAGGACTGGTGAAAGG + Intergenic
1038212281 8:25530103-25530125 CAAAAATAAGCAATGGAGAAAGG - Intergenic
1038465490 8:27758944-27758966 CTACAAAGAGCAGGGGAGAATGG + Intronic
1038863941 8:31418250-31418272 CAGAAAAAAGCATTAGAGACAGG - Intergenic
1039302844 8:36228608-36228630 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039631441 8:39115996-39116018 CAATAACAAGCAATGGAGAAAGG - Intronic
1039674136 8:39641263-39641285 CAAAAACAAGCAGTGGGGAAAGG - Intronic
1039786399 8:40838189-40838211 CAGCTAAAAGGCGTGAAGAACGG - Intronic
1039892382 8:41694269-41694291 GAGTAAGAAGCAGAGGAGAAGGG - Intronic
1040677951 8:49773944-49773966 CAAAAACAAGCACTGGAGAAAGG + Intergenic
1040684250 8:49852018-49852040 AAAAAAAAAGCAATGGAGAAAGG + Intergenic
1040774748 8:51028187-51028209 CCAAAAAAAGCAGTGGAGAAAGG - Intergenic
1040926777 8:52693005-52693027 CAGAAACAAGCAATGGGGAAAGG + Intronic
1041017523 8:53606430-53606452 CAATAACAAGCAATGGAGAAAGG + Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1041269376 8:56096102-56096124 CAGCAAAAAGGAGTTGAGCATGG - Intergenic
1041427111 8:57734410-57734432 CAGAAACAAGCAATGGAGGAAGG - Intergenic
1041598304 8:59683527-59683549 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1041725014 8:61010150-61010172 CAGCAACAAGCAGAGGTGAATGG - Intergenic
1041840804 8:62268470-62268492 CAGCAAGAAGGACTGGAGAATGG + Intronic
1041852826 8:62412317-62412339 CAAAAAAAAACAGTGGGGAAAGG + Intronic
1042083179 8:65078254-65078276 CAGCAAAGAGCAGAAGTGAAAGG + Intergenic
1042361280 8:67885861-67885883 CAGCAAGCAGCAGTGGAGTTTGG - Intergenic
1043002405 8:74775113-74775135 CTGCTAAAAGCATGGGAGAAGGG - Intronic
1043032202 8:75150889-75150911 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1043569529 8:81587052-81587074 CAATAACAAGCAGTGGGGAAAGG - Intergenic
1043732446 8:83700555-83700577 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1043748474 8:83905733-83905755 CACAAAAAAGCAATGGGGAAAGG - Intergenic
1043836003 8:85046897-85046919 CAGAAACAAGCAATGGGGAAAGG - Intergenic
1044212005 8:89561365-89561387 CACCAAAAGGCAGTGGTAAAAGG - Intergenic
1044772946 8:95656485-95656507 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1044914003 8:97092553-97092575 CAGTAAAAAACAATGGGGAAAGG + Intronic
1045165689 8:99602257-99602279 CAAAAACAAGCAATGGAGAAAGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045952813 8:107870800-107870822 CAAAAATAAGCAGTGGGGAAAGG + Intergenic
1045971927 8:108088465-108088487 CTGACAAAAGCAGTGGGGAAAGG + Intergenic
1045978244 8:108153933-108153955 CAGAAACAAGTAATGGAGAAAGG + Intergenic
1046042411 8:108921855-108921877 CAGAAAAAAGAAGGGCAGAAAGG + Intergenic
1046142044 8:110106603-110106625 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1046189768 8:110778297-110778319 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1046338484 8:112821909-112821931 CAAAAACAAGCAATGGAGAAAGG - Intronic
1046409082 8:113815368-113815390 CAAAAATAAGCAGTGGGGAAAGG - Intergenic
1046413319 8:113877016-113877038 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1046807529 8:118496452-118496474 CAATAACAAGCAATGGAGAAAGG + Intronic
1046977851 8:120302499-120302521 CAAAAACAAGCAATGGAGAAAGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047363292 8:124189258-124189280 CAATAACAAGCAATGGAGAAAGG - Intergenic
1047813180 8:128432708-128432730 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1047919912 8:129624460-129624482 CAAAAATAAGCAGTGGGGAAAGG - Intergenic
1048041856 8:130738011-130738033 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1048124621 8:131619931-131619953 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1050004091 9:1109739-1109761 CACCAACAAGCAATGGAAAAAGG - Intergenic
1050141141 9:2516938-2516960 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1050425298 9:5506895-5506917 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1050616818 9:7409897-7409919 CAGCATAAAGTAGTGGTGTAGGG + Intergenic
1050865599 9:10493480-10493502 CAGAAACAAGCAATGGGGAAAGG + Intronic
1050921983 9:11215110-11215132 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1051045312 9:12866073-12866095 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1052220887 9:26020341-26020363 CTGTAAAAGGCAGTGTAGAAGGG - Intergenic
1052411282 9:28124810-28124832 CAGCAAGAATCACTGAAGAAAGG - Intronic
1052779985 9:32771697-32771719 CAGAAACAAGCAATGGAGAAAGG - Intergenic
1052902890 9:33809810-33809832 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1053751339 9:41259369-41259391 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1054256861 9:62823698-62823720 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1054334443 9:63791915-63791937 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1054864213 9:69983462-69983484 AAGCAAAAAGCAATGGGCAAGGG - Intergenic
1054903191 9:70390928-70390950 CATCAGAAGGGAGTGGAGAAAGG - Intronic
1054970146 9:71076614-71076636 CACCAGAAATCAGGGGAGAAAGG + Intronic
1055275320 9:74609325-74609347 GAGAAAAAAGCAATGGTGAAAGG - Intronic
1055484954 9:76747784-76747806 AAAAAAAAAGAAGTGGAGAATGG - Intronic
1055611015 9:78024300-78024322 CAGCAAAGAGGAGTGGAAAATGG + Intronic
1055629233 9:78206126-78206148 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1055744027 9:79423036-79423058 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1055850808 9:80627537-80627559 CAACAGAAAGCAATGGAGAAGGG + Intergenic
1056384735 9:86086712-86086734 CAAAAACAAGCAATGGAGAAAGG - Intronic
1056489822 9:87094886-87094908 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1056809388 9:89752496-89752518 CATCAAAGAGCAGTGGGAAATGG - Intergenic
1056821707 9:89846849-89846871 CAGCAAGAAGGACTGGAAAAAGG - Intergenic
1056997651 9:91478745-91478767 CAGGAAAAAACAGTGCAAAAAGG - Intergenic
1058041975 9:100312595-100312617 CTGCAAAAAACAGTGGAGAATGG - Intronic
1058274979 9:103028507-103028529 CAGCAAAAAGCAGTTCTAAAAGG + Intergenic
1058289611 9:103222631-103222653 CAAAAACAAGTAGTGGAGAAAGG + Intergenic
1058558614 9:106199601-106199623 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1059880284 9:118681227-118681249 CAGTGAAAAGCAGTAGAAAATGG + Intergenic
1059895802 9:118863434-118863456 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1060454235 9:123775837-123775859 CACGAAAAAGCAGTCGATAATGG + Intronic
1061163562 9:128909865-128909887 CCACCAAATGCAGTGGAGAAAGG - Intronic
1061689714 9:132316670-132316692 CATCACAAATCAGTGGGGAAAGG - Intronic
1062031472 9:134363929-134363951 CAGAAAAAAGAAGAAGAGAAAGG + Intronic
1203431330 Un_GL000195v1:93508-93530 CACCAGAAAGCAGTGGGGACTGG - Intergenic
1203435174 Un_GL000195v1:131115-131137 CACCAGAAAGCAGTGGGGACTGG + Intergenic
1203571716 Un_KI270744v1:139036-139058 AAGGAAAAAGCAGAAGAGAAAGG + Intergenic
1203612989 Un_KI270749v1:27065-27087 CAGCAAAAAGCCGTGGCGGCGGG - Intergenic
1203613136 Un_KI270749v1:27674-27696 CTGCAAAAAGCAGCGGCGACAGG - Intergenic
1185764913 X:2717355-2717377 AAAAAAAAAGAAGTGGAGAAGGG + Intronic
1186326487 X:8482714-8482736 CAGAAAGGAGCAGTGGGGAAGGG - Intergenic
1186556164 X:10561099-10561121 CAAAAACAAGCAATGGAGAAAGG + Intronic
1186586820 X:10884071-10884093 CTACAAAAAGCAGTAGAGTATGG + Intergenic
1186866350 X:13724440-13724462 CAGGAAAAAGCAAGGGAGAAGGG + Intronic
1187377907 X:18773592-18773614 CAGCAAAAAGAAAAGGAAAAGGG - Intronic
1187896599 X:23987444-23987466 CAGCAAAAAGCCATGCAAAAAGG + Exonic
1188109250 X:26177804-26177826 CTGAGAAAAGCAATGGAGAAAGG - Intergenic
1188109937 X:26185074-26185096 CTGAGAAAAGCAATGGAGAAAGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188413687 X:29905628-29905650 CAGCAACAAGCAATGGGGAAAGG - Intronic
1188560780 X:31466426-31466448 CAAAAACAAGCAATGGAGAAAGG - Intronic
1188710760 X:33394597-33394619 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1188894536 X:35650779-35650801 CAGCAGAAGGCAATAGAGAAGGG + Intergenic
1188928593 X:36076997-36077019 CAAAAATAAGCAATGGAGAAAGG - Intronic
1189018004 X:37304262-37304284 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1189125958 X:38446478-38446500 CAACAATAAGCAATGGGGAAAGG - Intronic
1189243834 X:39547300-39547322 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1189362703 X:40365495-40365517 CAAAAATAAGCAATGGAGAAAGG - Intergenic
1189930043 X:45999577-45999599 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1190094947 X:47471480-47471502 CACTACAGAGCAGTGGAGAAAGG - Intronic
1190616994 X:52244050-52244072 CAGAAACAAGCAGTGGAGAAAGG + Intergenic
1190683545 X:52850639-52850661 CAGCAGTAAGCAGTGGAGCATGG + Intergenic
1190686352 X:52877216-52877238 TAGCAGAAAGCTGGGGAGAAAGG - Intergenic
1190919238 X:54835547-54835569 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1191110437 X:56799713-56799735 CAGCAAAAGGAAGGAGAGAAAGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191189954 X:57656036-57656058 CAGCAGAAAGCAGTTAAGATTGG + Intergenic
1191632381 X:63336098-63336120 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1191652056 X:63549982-63550004 CTGACAAAAGCAATGGAGAAAGG - Intergenic
1191653246 X:63565034-63565056 CTGACAAAAGCAATGGAGAAAGG - Intergenic
1191725956 X:64281432-64281454 CAACAACAAGTAATGGAGAAAGG + Intronic
1191729670 X:64319663-64319685 CAAAAAAAAGCAATGGGGAAAGG - Intronic
1191763723 X:64672408-64672430 CAATAACAAGCAGTGGGGAAAGG + Intergenic
1192241314 X:69332059-69332081 CAGAAAAAAGCATTTGATAAAGG - Intergenic
1192242053 X:69340023-69340045 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1192388990 X:70705055-70705077 CAAAAACAAGCAATGGAGAAAGG - Intronic
1192712199 X:73602774-73602796 CAGAAACAAGCAATGGGGAAAGG - Intronic
1192851498 X:74961203-74961225 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192866328 X:75136768-75136790 CAGTAACAAGCAATGGGGAAAGG + Intronic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193019494 X:76776031-76776053 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1193069237 X:77290301-77290323 CAAAAACAAGCAGTGGGGAAAGG - Intergenic
1193110237 X:77722056-77722078 CAAAAACAAGCAATGGAGAAAGG + Intronic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193385285 X:80863668-80863690 CATAAAAAAGCAATGGGGAAAGG - Intergenic
1193440807 X:81537602-81537624 CAGCAAAAAGCTCAGGAGTATGG - Intergenic
1193583318 X:83291142-83291164 CAAAAAGAAGCAATGGAGAAAGG + Intergenic
1193634426 X:83930787-83930809 CTGTGAAAAGCAGAGGAGAAAGG - Intergenic
1193703810 X:84795569-84795591 CAAGAACAAGCAGTGGGGAAAGG + Intergenic
1193757193 X:85423096-85423118 CAAAAAGAAGCAATGGAGAAAGG - Intergenic
1193771063 X:85588019-85588041 CAAAAACAAGCAGTGGGGAAAGG + Intergenic
1193897381 X:87129631-87129653 GAGCAAAAAACAGTGCAAAATGG + Intergenic
1193981137 X:88183214-88183236 CAGCAAGAAGCAATGAAGAAAGG - Intergenic
1193984566 X:88224468-88224490 CAAAAATAAGCAATGGAGAAAGG - Intergenic
1194139676 X:90194328-90194350 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1194185487 X:90769845-90769867 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1194191419 X:90841090-90841112 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1194290097 X:92061557-92061579 CAAAAACAAGCAATGGAGAAAGG - Intronic
1194404339 X:93476349-93476371 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1194855732 X:98926367-98926389 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1194904820 X:99561631-99561653 CAACAACAAGCAATGGGGAAGGG + Intergenic
1194949579 X:100109328-100109350 CAGAGAAAGGCAATGGAGAAGGG + Intergenic
1195068758 X:101260196-101260218 CAGGACAAAGCCATGGAGAAAGG - Intronic
1195110499 X:101643534-101643556 CAGCACAAATCAATGGAGAAAGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195869709 X:109473197-109473219 CAGCAACAGGAAGTGGAGGAGGG - Intronic
1196000400 X:110777984-110778006 CAAAAACAAGCAATGGAGAAAGG + Intronic
1196022575 X:111005875-111005897 CATCAAAAAGCAATGAGGAAAGG + Intronic
1196154586 X:112414167-112414189 CAACAAAAAAAAGTGGGGAAAGG - Intergenic
1196280682 X:113820452-113820474 CAGAAACAAGCAATGGAGAAAGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196517738 X:116632942-116632964 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1196540620 X:116902679-116902701 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1196576913 X:117329207-117329229 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1196606838 X:117666783-117666805 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1197082072 X:122430479-122430501 AAGAAACAAGCAATGGAGAAAGG - Intergenic
1197474862 X:126909498-126909520 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1197531039 X:127626590-127626612 CAAAAACAAGCAATGGAGAAAGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198143132 X:133826030-133826052 CAGCAACAAACACTGGGGAAGGG + Intronic
1198294948 X:135277747-135277769 CAACAACAAGCAATGGGGAAAGG - Intronic
1198500504 X:137240620-137240642 CTACAAAAACAAGTGGAGAAAGG + Intergenic
1198519121 X:137434409-137434431 GAGGAAAAACCAGTGGAAAAAGG + Intergenic
1198577951 X:138031295-138031317 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1198687500 X:139242903-139242925 CAAAAACAAGCAGTGAAGAAAGG + Intergenic
1199282013 X:146012894-146012916 CAATAATAAGCAATGGAGAAAGG + Intergenic
1199317481 X:146397487-146397509 CAGCAAAAAGCAGTGCTAAGAGG - Intergenic
1199322737 X:146460326-146460348 CAAAAAAAAGCAATGGGGAAAGG + Intergenic
1199353510 X:146832667-146832689 CAAAAATAAGCAGTGGGGAAAGG - Intergenic
1199436733 X:147820415-147820437 GAGGAAAAAGCAGTGCAAAAAGG + Intergenic
1199649253 X:149937827-149937849 CAGAATTAAGCAGTGGACAATGG - Intronic
1199838014 X:151613077-151613099 CAAAAACAAGAAGTGGAGAAAGG - Intronic
1200034647 X:153319560-153319582 CTGCAGAAGGCCGTGGAGAAGGG - Intergenic
1200378383 X:155808478-155808500 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1200380536 X:155833100-155833122 CAAAAATAAGCAATGGAGAAAGG + Intergenic
1200485419 Y:3763293-3763315 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1200538062 Y:4423505-4423527 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1200607610 Y:5286131-5286153 CAAAAACAAGCAATGGAGAAAGG - Intronic
1200739835 Y:6842102-6842124 CAGAAATAAGCAATGGGGAAAGG - Intergenic
1200867139 Y:8056755-8056777 CAACAACAAGAAATGGAGAAGGG - Intergenic
1201021571 Y:9663788-9663810 CAACAACAAGCAATGGGGAAAGG + Intergenic
1201050633 Y:9930252-9930274 CAGAAACAAGCAATGGGGAAAGG + Intergenic
1201194801 Y:11481600-11481622 GTGCAAAAAGCCGTGGAGATGGG + Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201704338 Y:16919041-16919063 CAAAAACAAGCAATGGAGAAAGG - Intergenic
1201787879 Y:17805583-17805605 CAGACAAAAGCAATGGGGAAAGG - Intergenic
1201813674 Y:18100405-18100427 CAGACAAAAGCAATGGGGAAAGG + Intergenic