ID: 1006878285

View in Genome Browser
Species Human (GRCh38)
Location 6:37317192-37317214
Sequence GAGGAGGATTTTCAGGTGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006878280_1006878285 12 Left 1006878280 6:37317157-37317179 CCTTCTTGATCAAGTGGAGGAAA 0: 1
1: 0
2: 12
3: 367
4: 1022
Right 1006878285 6:37317192-37317214 GAGGAGGATTTTCAGGTGAGTGG 0: 1
1: 1
2: 2
3: 33
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006878285 Original CRISPR GAGGAGGATTTTCAGGTGAG TGG Exonic
900967037 1:5966012-5966034 GAAGAGGAATTTCTGCTGAGTGG - Intronic
901067604 1:6501891-6501913 GTGGAGGGTTCACAGGTGAGGGG - Intronic
901085965 1:6612913-6612935 CCGGAGGATATTCAGGAGAGTGG + Intronic
901144515 1:7056027-7056049 GCACAGGATCTTCAGGTGAGAGG - Intronic
901569508 1:10148154-10148176 GAGGCGGAGCTTCCGGTGAGCGG + Intronic
901882485 1:12202348-12202370 AGGGAGGATTTTGAGGTGATAGG - Intronic
902374064 1:16022049-16022071 CAGGAGGACTGACAGGTGAGGGG + Exonic
902378990 1:16043866-16043888 CAGGAGGACTGACAGGTGAGGGG + Exonic
902736904 1:18407321-18407343 GAGGAGGTTTCTGAGGTCAGAGG - Intergenic
903390639 1:22961432-22961454 GAGGTGGAGTTTACGGTGAGTGG - Intronic
904452795 1:30626969-30626991 GAGGAGGAGGTTGTGGTGAGAGG + Intergenic
904485532 1:30822529-30822551 GAGCAGGTTTCTCTGGTGAGGGG - Intergenic
904902187 1:33866215-33866237 GTGGAGGATTTTCATGTGCCAGG + Intronic
905070768 1:35223422-35223444 GAGGAGGGTTTTGAGGCAAGAGG - Intergenic
906261575 1:44395745-44395767 GAGGCGGAAGTTGAGGTGAGTGG - Intergenic
906508932 1:46400299-46400321 GATGGGGATTTTAAGGGGAGAGG + Intronic
907504487 1:54907810-54907832 AAGGAGGATTTTGTGGTAAGGGG + Intergenic
907589421 1:55652044-55652066 GAGGAGGAGATTAATGTGAGAGG - Intergenic
908299320 1:62746508-62746530 GAGGAGGTTTCTCAGCTCAGAGG + Intergenic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909496258 1:76282223-76282245 TGTGAGGAATTTCAGGTGAGAGG + Intronic
909869517 1:80722424-80722446 CAGGCGGTTTTTCAGGTCAGAGG + Intergenic
910002698 1:82358085-82358107 CAGGAGGCTTCTCAGGTGATCGG + Intergenic
910239299 1:85069238-85069260 GAAGAGTATTTTCAGGTGGAGGG - Intronic
910382907 1:86648599-86648621 TAGGAGGATTTTAAGTTTAGTGG - Intergenic
911089432 1:94006761-94006783 GAGGATGGCTTTCAGGAGAGAGG + Intronic
911147508 1:94567034-94567056 AAGGAGGATTTTGTGGTAAGGGG + Intergenic
911335187 1:96573516-96573538 GAGGAAGATATCCAGGAGAGAGG - Intergenic
911412193 1:97523790-97523812 AAGGAGGATTTTTAGTGGAGAGG - Intronic
911504572 1:98732756-98732778 GAGGAGGATTATCATTTTAGAGG + Intronic
912975321 1:114324290-114324312 GAGGAGGCTGTTCAGGGAAGAGG - Intergenic
913017226 1:114751379-114751401 AAGAATGATTATCAGGTGAGAGG + Intronic
913312455 1:117514743-117514765 GGTGAGGATTCTCAGATGAGGGG + Intronic
914809118 1:151013852-151013874 GAGGAGGAATTACAAGTCAGAGG + Intronic
916415768 1:164590482-164590504 GAGGAGGAAGTTAAGTTGAGAGG + Intronic
916879323 1:169004125-169004147 GAGGAGGATTTTGAGGTGAGAGG + Intergenic
916941372 1:169682155-169682177 AAGGAGGAGTTTAAGGTGAAGGG - Intronic
917713249 1:177708906-177708928 GAGGTTGTGTTTCAGGTGAGAGG - Intergenic
918001055 1:180496544-180496566 GAAAAGGCATTTCAGGTGAGTGG - Intronic
919934668 1:202243651-202243673 GAGGAGGATCTTGTGGTGACAGG + Intronic
920160970 1:203997364-203997386 GAGGAGGATCATCAGGGCAGTGG + Intergenic
920414428 1:205789325-205789347 GAGGAGGACTGTAGGGTGAGAGG - Exonic
920426844 1:205885163-205885185 AAGGAAGATTTTCTGGTAAGGGG + Intergenic
920511069 1:206552405-206552427 GAGGAGGATTTTGACATCAGAGG + Intronic
922008479 1:221556292-221556314 GAGGAGCTTTTTCAGGTCACAGG - Intergenic
922194230 1:223345924-223345946 GAGGAGGAGCTCCAGGTGAGAGG - Intronic
923680925 1:236117943-236117965 GATCAGGAGTTTCAGGTGTGGGG - Intergenic
924638470 1:245810632-245810654 GAGCAGCAGTTTCAGGTGTGAGG + Intronic
1062945152 10:1455176-1455198 GAGGATGGATTGCAGGTGAGAGG + Intronic
1063588772 10:7376626-7376648 GAGGAGGAGCTTAAAGTGAGCGG + Intronic
1063866544 10:10371279-10371301 GAAGAGAATTCACAGGTGAGTGG - Intergenic
1064199708 10:13274128-13274150 GGGGAGGAATCTCAGGAGAGGGG + Intergenic
1064482052 10:15749632-15749654 GAGGAGGCTTTTCTGGTGTGTGG + Intergenic
1065319858 10:24499353-24499375 GAGGATGATTTTGATTTGAGGGG + Intronic
1065595768 10:27309522-27309544 GAGTAGGATTTAAAAGTGAGTGG + Intergenic
1066251200 10:33634396-33634418 GAGGAAGATATTTAGGTGAAGGG + Intergenic
1068680705 10:59817028-59817050 GAGGAGCATTTGCACGTTAGTGG - Intronic
1069863721 10:71487116-71487138 GAGGATGAGTTGGAGGTGAGAGG - Intronic
1070291912 10:75122757-75122779 GAGGAGGATTTTTTGGGGAAGGG - Intronic
1070330182 10:75410710-75410732 TAGCAGGAGTTCCAGGTGAGGGG - Intergenic
1071236942 10:83660217-83660239 TAGTAGAATTATCAGGTGAGGGG - Intergenic
1071276408 10:84059633-84059655 AAGGTGGATTTGGAGGTGAGAGG - Intergenic
1071821785 10:89287180-89287202 CAGGAGGCTTCTCAGGTGATCGG - Intronic
1074696771 10:116056876-116056898 CAGGAGGGTTTTCCGGTGAATGG + Intergenic
1074781595 10:116806307-116806329 GAGGAGGAGGCTGAGGTGAGAGG - Intergenic
1075597651 10:123743818-123743840 CAGGAGGGTTTTCAGCTGTGAGG + Intronic
1076276721 10:129205777-129205799 GAGGAGCAGTTTCAGGTGGATGG - Intergenic
1077948026 11:6923868-6923890 GAGCAGTATCTTCAGGAGAGTGG - Intergenic
1078159869 11:8831252-8831274 GGGGAGGATTGTCAGGAGATCGG + Intronic
1078836318 11:15034205-15034227 AAGGATGATTGTGAGGTGAGGGG - Intronic
1079400204 11:20100805-20100827 GTGCAGGAGTCTCAGGTGAGTGG + Intronic
1080580555 11:33639467-33639489 AAGGAGAATTACCAGGTGAGAGG - Intronic
1080615082 11:33938706-33938728 CAGGAGAAGGTTCAGGTGAGGGG - Intergenic
1081692330 11:45086867-45086889 GAGAAGGAATTCCAGGTGGGGGG - Intergenic
1082861218 11:57858449-57858471 GAGGTGGATGTTGCGGTGAGTGG - Intergenic
1083309698 11:61777914-61777936 GAGTAGGATTTCCAGGTGACAGG - Intronic
1083364978 11:62136984-62137006 GAGGAGGATGTCCAGGCCAGTGG - Intronic
1083465072 11:62840070-62840092 GAGGCGGAGGTTGAGGTGAGAGG - Intronic
1088797535 11:113276313-113276335 GAGATGGATTTTCACCTGAGTGG - Exonic
1089196080 11:116694724-116694746 GAGGAGTCTTCTCTGGTGAGGGG - Intergenic
1090132745 11:124161779-124161801 GAGGAGTATTTTCCAGGGAGAGG + Intergenic
1090168958 11:124581444-124581466 GTGAGGGATTTTCAGGGGAGAGG - Intergenic
1091145762 11:133278592-133278614 GAGGAGGAGATTGAGATGAGAGG + Intronic
1092580328 12:9834518-9834540 CAGGAGGATTTTGTGGTAAGGGG + Intronic
1092973885 12:13725319-13725341 GAGGAGGATGTGCAGGTAAGAGG + Intronic
1093369652 12:18352411-18352433 GGGGAGGACATACAGGTGAGTGG + Intronic
1095247200 12:39936760-39936782 GAAGAGGATTATAAGGGGAGGGG + Intronic
1095805994 12:46321849-46321871 AAGGAGGATTTTGTGGTAAGGGG + Intergenic
1096678833 12:53241704-53241726 TTGGAGGATTTTCAGGGGAGAGG + Intergenic
1097246029 12:57608147-57608169 TAGGAGTATTTTCAGGTGAAGGG + Intronic
1098222193 12:68282038-68282060 GAGGAGGACCCTGAGGTGAGAGG - Intronic
1098639104 12:72818267-72818289 GAGGAAGATTTTGTGGTAAGGGG + Intergenic
1100142048 12:91631317-91631339 GAGTAGAATTTTCAAGTGAGAGG - Intergenic
1100505679 12:95217872-95217894 GAGGTGGTTTTTGAGGTAAGAGG + Exonic
1102808415 12:115802530-115802552 GAGGAGGAATTTGAGGGGTGGGG - Intergenic
1102908425 12:116694794-116694816 GGGGAGGATCGTCAGGAGAGGGG + Intergenic
1103086687 12:118066927-118066949 GAGAGGGCGTTTCAGGTGAGGGG - Intronic
1103220274 12:119238717-119238739 GAGGAGGGTTTTAAGGTCACAGG - Intergenic
1103899656 12:124296615-124296637 GAGGAGGATTTTCAGCGGCGGGG - Intronic
1104683399 12:130767953-130767975 GAGGAACAATTCCAGGTGAGTGG - Intergenic
1105032994 12:132897850-132897872 AAGGAGGATTTTGTGGTAAGGGG - Intronic
1105216381 13:18288988-18289010 TAAGTGGATTTTCAGGTTAGTGG - Intergenic
1106307126 13:28522671-28522693 GAGAAGGGTTTTGGGGTGAGGGG - Intergenic
1107141546 13:37003770-37003792 GATGAGGAGTTTAAGGTAAGAGG + Intronic
1110739040 13:78972849-78972871 GGGAACAATTTTCAGGTGAGTGG + Intergenic
1111237143 13:85423859-85423881 AAGGATGAGTCTCAGGTGAGGGG + Intergenic
1111512061 13:89279308-89279330 GGGGAGGCTTTGCTGGTGAGTGG - Intergenic
1113173565 13:107534785-107534807 GAGGAGAAGCTTCAGGTCAGTGG - Intronic
1113510005 13:110846393-110846415 GAGGAGGGTTTTCAAGGGTGGGG + Intergenic
1113666107 13:112143074-112143096 GAGGAGGTTGTTCAGGTGCAGGG + Intergenic
1114206748 14:20579172-20579194 GAGGAGGAATATGAGGTGGGAGG - Intergenic
1116885169 14:50213598-50213620 GAGGTGGAGGTTGAGGTGAGTGG + Intronic
1118380374 14:65213064-65213086 GAGGAGAACTTTCAGGTCACAGG + Intergenic
1118783144 14:69023615-69023637 GAGGAGGAGGTTGGGGTGAGCGG + Intergenic
1118833339 14:69456364-69456386 GAGAAGGCTTTTCAGGTAAATGG + Intronic
1118903932 14:70009938-70009960 GGGAAGAATTTTCAGGTAAGTGG + Intronic
1119380319 14:74224238-74224260 GAGCAGGATATTCATGTGAAGGG - Intergenic
1120245349 14:81999317-81999339 GAGCAGGATTTGGAGGTGGGTGG + Intergenic
1120892083 14:89500358-89500380 GAGTTGGGTTTTCAGGTGAGTGG - Intronic
1121389224 14:93560011-93560033 AAGGAGGATTTTGTGGTAAGGGG + Intronic
1122152247 14:99731513-99731535 GAGAAGGATTTACTGGGGAGAGG - Intergenic
1122588617 14:102829000-102829022 GAAGAGCATTTTCAGATGTGTGG + Intronic
1124075501 15:26440217-26440239 AAGGAGGTTTTTCAGGTGAAAGG - Intergenic
1124581395 15:30958293-30958315 GAAGAGGAGCTTCAGGAGAGTGG + Intronic
1125203148 15:37120038-37120060 GAGGCGGAGCTTGAGGTGAGCGG + Intergenic
1125528122 15:40392009-40392031 ATGGAGGAGTTACAGGTGAGAGG + Exonic
1126844256 15:52744593-52744615 AAGGAAGATTTTGTGGTGAGGGG - Intergenic
1126982129 15:54255922-54255944 ATGGAGCATTTTCAGGTGATGGG + Intronic
1128213586 15:65918640-65918662 GAGGAAGATGTTGAGCTGAGAGG - Intronic
1128563714 15:68685279-68685301 GAGGAGGAGGTTGAAGTGAGCGG - Intronic
1129452282 15:75657824-75657846 GAGAAGGACTTTCAGGGGAGAGG + Exonic
1130677844 15:85969466-85969488 GAGGAGGCTGTTCATGTGTGAGG - Intergenic
1132945906 16:2531321-2531343 CAGGATGATTTTGAGGTGTGGGG + Exonic
1133661068 16:7918351-7918373 AAGGATGATTTTCTGGTTAGAGG + Intergenic
1133832178 16:9333314-9333336 GGGGAGGAGTGGCAGGTGAGAGG + Intergenic
1137063225 16:35811037-35811059 GAGGAGGAAGTCCAGGTAAGAGG + Intergenic
1140271088 16:73466842-73466864 AAGGAGGATGTTCAGGAGACTGG + Intergenic
1140692642 16:77499059-77499081 GAGGAGGAATGAGAGGTGAGAGG + Intergenic
1141438424 16:84014108-84014130 GAGGAGGTTTTAGAGGTGAGGGG - Intronic
1142602300 17:1059625-1059647 GAGGATGAATGTCTGGTGAGAGG - Intronic
1143072826 17:4311869-4311891 GAGGAGGTTTGTCAAGAGAGGGG + Intronic
1143628665 17:8124836-8124858 GAGGAGGATCTTCAAGGCAGAGG + Intergenic
1145327944 17:21847485-21847507 GAGGAGGAGCTTGTGGTGAGTGG + Intergenic
1146074634 17:29716827-29716849 GGGGAGGAGTTTCAGAGGAGTGG - Intronic
1146526549 17:33571933-33571955 GAGGTGAAATTCCAGGTGAGAGG + Intronic
1146585940 17:34081572-34081594 GAGAAGGATTTTGAGGTGGTGGG - Intronic
1147978965 17:44263083-44263105 GAGCTGGATTTGCAGGTGTGAGG + Intronic
1148475661 17:47927046-47927068 GAGGGGGATTTTCCTGTGATGGG + Intronic
1148565041 17:48627592-48627614 GAGCAGGAGCCTCAGGTGAGAGG - Intronic
1148771793 17:50071596-50071618 GTGGAGGATTTGCAGTTGTGCGG + Intronic
1150592775 17:66578042-66578064 GAGGAGGAGTTGCAGGAGAAAGG - Intronic
1150876648 17:68977899-68977921 CAGGAGGAATTTGAGGTGGGAGG + Intronic
1151811124 17:76442688-76442710 GAGCAGGATGTGTAGGTGAGGGG + Intronic
1152096972 17:78278226-78278248 GAGGCGGGGTTGCAGGTGAGGGG - Intergenic
1152691062 17:81717847-81717869 AAGGGGGAGTATCAGGTGAGTGG + Exonic
1203192574 17_KI270729v1_random:203713-203735 GAGGAGGAGCTTGTGGTGAGTGG + Intergenic
1203201939 17_KI270730v1_random:3148-3170 GAGGAGGAGCTTGTGGTGAGTGG + Intergenic
1155106859 18:22675546-22675568 GATGAGGGTTTTAATGTGAGAGG - Intergenic
1155353493 18:24929058-24929080 GAGGAGCATGCACAGGTGAGGGG + Intergenic
1156573022 18:38280381-38280403 GAGGAGGTTCTTCAGAGGAGAGG - Intergenic
1157328696 18:46687633-46687655 GGGGAGGAGCTGCAGGTGAGCGG - Intronic
1157533556 18:48442051-48442073 GAGGAAGAATTTCAGATGGGGGG - Intergenic
1157595237 18:48860144-48860166 GAGGAGGACTTGGAGGTGGGAGG - Exonic
1157842793 18:50975013-50975035 GAGGAGGAATTTCAGGGCTGAGG + Intronic
1160345980 18:78132186-78132208 GAAGAGGCTTTTCAGATGAAAGG + Intergenic
1160367028 18:78335358-78335380 GAGGAGGAGGGGCAGGTGAGGGG + Intergenic
1163080226 19:14934243-14934265 GAGGAGGAGCTTACGGTGAGCGG + Intergenic
1164900271 19:31914112-31914134 GAGGAGGAGTTTGCAGTGAGTGG - Intergenic
1165927329 19:39335253-39335275 GAGGAAGAATTTCAGGTGATGGG - Exonic
1166947942 19:46408653-46408675 GGGGAGGCTTTGCAGGTGCGCGG - Intergenic
1167412876 19:49355429-49355451 GAGGCGGAAGTTCATGTGAGAGG + Intronic
1167573710 19:50307012-50307034 GAGGAGGAGTCTCAGTAGAGGGG - Intronic
1168257523 19:55174874-55174896 TAGGAGGACTGTCAGGTGTGTGG - Exonic
925427763 2:3764768-3764790 GAGGAGCTGTTCCAGGTGAGAGG + Intronic
925444966 2:3919765-3919787 GAGGTGGTTCTCCAGGTGAGTGG + Intergenic
925444980 2:3919860-3919882 GAGGTGGTTCTGCAGGTGAGAGG + Intergenic
925557054 2:5143173-5143195 TAGCACGATTTTCAGGTAAGTGG - Intergenic
926596387 2:14794154-14794176 GTGGACAATTTTCAGGTAAGGGG - Intergenic
927280555 2:21301772-21301794 GAAGATTATTTTCAGGTAAGAGG + Intergenic
928323719 2:30303430-30303452 GTGGGGTATTTTCAGGTGAGAGG + Intronic
928383126 2:30838416-30838438 GGGCAGGATTAGCAGGTGAGAGG + Intergenic
930175401 2:48296245-48296267 TAGGAGGCTATTCAAGTGAGAGG + Intergenic
931485938 2:62691624-62691646 TTAGAGGATTTTCAGTTGAGGGG - Intronic
931645575 2:64418880-64418902 GAGGAAGAGTGTCAGGCGAGTGG - Intergenic
932886198 2:75551439-75551461 GAGGAGAGTTTCCAGGAGAGGGG - Intronic
937048636 2:118869628-118869650 ACGGAGGATTTACAGGTGAAAGG - Intergenic
937523240 2:122736640-122736662 GAGGAAAGATTTCAGGTGAGAGG - Intergenic
937925394 2:127163877-127163899 AAGGAGGACTTTCAGGTCATAGG - Intergenic
941746229 2:169089466-169089488 GCGGAAGATATTCAGCTGAGTGG + Intronic
943496940 2:188631813-188631835 GAGGAAAAATTTCAGCTGAGAGG - Intergenic
944251910 2:197587167-197587189 AAGGAGGATTTTGTGGTAAGGGG - Intronic
944640754 2:201723058-201723080 AAGGAGAATTTTCAGATGACTGG - Exonic
944988066 2:205201764-205201786 GAGGTGGAGTTTGCGGTGAGCGG + Intronic
946658632 2:221976172-221976194 CAGGAGGAGTTTTAGGTGTGTGG - Intergenic
946701950 2:222423862-222423884 GGGGAACATTTTCAGGTGGGTGG - Intergenic
947494986 2:230628531-230628553 GCAGTGGATGTTCAGGTGAGCGG - Intergenic
1168815443 20:733683-733705 GAGGAGGCATTTCAGTGGAGAGG + Intergenic
1170235245 20:14096435-14096457 GAGGAGGATATTGTGGTGAGCGG - Intronic
1170562478 20:17569610-17569632 GAGGGGGATTTGGAGGGGAGAGG - Intergenic
1170923718 20:20703436-20703458 AAATAGCATTTTCAGGTGAGAGG - Intronic
1171208055 20:23296365-23296387 GAGGTGGATGTTGCGGTGAGTGG + Intergenic
1171558645 20:26099909-26099931 GAGGAGGAGCTTGTGGTGAGTGG - Intergenic
1172952234 20:38729534-38729556 GAGGAGGCTCCTCAGGTGTGAGG + Intergenic
1173146268 20:40527236-40527258 GAGCAGGAATTACAGGTGTGGGG - Intergenic
1174084348 20:47994938-47994960 GGGGAAGATGTACAGGTGAGGGG - Intergenic
1174699559 20:52594269-52594291 GAGGAGGTCTTGCAAGTGAGGGG + Intergenic
1175295579 20:57906746-57906768 GAAGAGGCTGTACAGGTGAGAGG - Intergenic
1175440132 20:58984545-58984567 GAGGATGATTTTCAGGTTTGGGG + Intronic
1176652369 21:9562699-9562721 GAGGAGGAGCTTGTGGTGAGTGG + Intergenic
1178669935 21:34581476-34581498 GAGGGGGCTTTTCAGGTATGAGG - Intronic
1180936076 22:19626082-19626104 GAGGAGGATGTCCAGGTGGTGGG - Intergenic
1182063177 22:27412345-27412367 GAGGAGGCGTTTTGGGTGAGTGG + Intergenic
1183623126 22:38986446-38986468 CAGGAGGATGAGCAGGTGAGAGG - Intronic
1183912652 22:41091481-41091503 GGGGAGGATTTTAAGGGGGGAGG - Intergenic
1184325187 22:43777607-43777629 GAGGAGGATGTTCAGGCTGGTGG - Intronic
1184397807 22:44255037-44255059 GAGGAGGAGGATCAGGAGAGGGG - Intronic
1184461043 22:44638299-44638321 GAGGAGGAGTTTGCAGTGAGCGG - Intergenic
1185078189 22:48694569-48694591 GAGGAGGCTTTTGGGGTGAGCGG - Intronic
950552253 3:13673700-13673722 GAGGAGGAGGTTGCGGTGAGTGG + Intergenic
951604919 3:24422534-24422556 GAGGAGGAAATTGAGGAGAGTGG - Intronic
951762020 3:26158244-26158266 AAGGAGGATTTTGTGGTAAGGGG + Intergenic
953485551 3:43291210-43291232 GAAGAGGCTTTTCAGGAAAGAGG - Intronic
953851706 3:46469965-46469987 GAGGAGGAGGGTTAGGTGAGGGG - Intronic
954662648 3:52234364-52234386 GAGGAGGATTGGGAGGTCAGAGG - Intronic
955684038 3:61532055-61532077 GAGGGGGCTTTTCTGGTGTGTGG - Intergenic
957941645 3:87013334-87013356 GAGGAGGTTATGCAGGTGAGAGG + Intergenic
958676313 3:97273030-97273052 AAGGAAGATTTTCTGGTAAGGGG + Intronic
962913056 3:139872602-139872624 GAGGAGGATGTTGCAGTGAGTGG + Intergenic
963074083 3:141330388-141330410 GAGGAAGGCTTTCTGGTGAGTGG - Intronic
963320561 3:143805282-143805304 AAGGAGGATTTTGTGGTAAGGGG - Intronic
963745801 3:149124350-149124372 GAGGAGGGTGTTCATGTGAGAGG - Intergenic
964004649 3:151812751-151812773 GAGGAGGATTATGAGGCAAGAGG - Intergenic
968752575 4:2397946-2397968 GAGGCGGGTTTCCAGGTGTGAGG + Intronic
968966364 4:3770963-3770985 GAGGAGGATCTGCAGTTCAGAGG - Intergenic
968968465 4:3781353-3781375 GGGGAGGAGTTTCATGTGAGGGG - Intergenic
968968476 4:3781409-3781431 GAGGAGGAGTTTCGTGTGTGGGG - Intergenic
968968486 4:3781465-3781487 GGGGAGGAGTTTCATGTGAGGGG - Intergenic
968968520 4:3781608-3781630 GGGGAGGAGTTTCGTGTGAGGGG - Intergenic
968968524 4:3781627-3781649 GGGGAGGAGTTTCATATGAGGGG - Intergenic
968968536 4:3781665-3781687 GCGGAGGAGTGTCATGTGAGGGG - Intergenic
968972713 4:3804240-3804262 GAGGAGGCATCTCTGGTGAGGGG - Intergenic
970255953 4:14170573-14170595 AAGGAAGATTTTGTGGTGAGGGG + Intergenic
971486929 4:27170077-27170099 GAGGAGGATTTATAGGTGAAAGG + Intergenic
971904497 4:32709312-32709334 GAGTAGGATTTTACTGTGAGGGG + Intergenic
972280456 4:37597138-37597160 GAGGAAGAGTTGCAGGTCAGTGG - Intronic
972282139 4:37612564-37612586 GAGGTGGAGATTGAGGTGAGTGG + Intronic
972703158 4:41513933-41513955 GAGGTGGAGGTTCCGGTGAGCGG + Intronic
973968064 4:56184032-56184054 CAGGAGGATCTTTAGATGAGAGG - Intronic
976396597 4:84562352-84562374 GAGGAGGATGTGCATGTGTGGGG + Intergenic
977293981 4:95191980-95192002 GAGGAGGATTAGCAGGGGGGAGG - Intronic
977581817 4:98733508-98733530 GAGGAGATTTCTCAGGTAAGAGG - Intergenic
980503098 4:133682254-133682276 CAGAAGAATGTTCAGGTGAGGGG + Intergenic
981532829 4:145768786-145768808 GAGGCGGAGTTTGTGGTGAGTGG + Intronic
982006291 4:151065798-151065820 GAGGCGGAGTTTGCGGTGAGCGG + Intergenic
982210973 4:153036063-153036085 GAGGAGGATTTGTATGTGTGTGG + Intergenic
982947513 4:161644190-161644212 GAGAAGGTTTTTCAGTAGAGAGG + Intronic
983212331 4:164971518-164971540 GAGGAGGAGGTTGTGGTGAGTGG + Intronic
985310115 4:188588621-188588643 CAGGAGGCTCTTCAGGAGAGAGG + Intergenic
985851051 5:2389365-2389387 CAGGAGGTTGTCCAGGTGAGAGG - Intergenic
985875566 5:2591462-2591484 GGGGAGGCTGTGCAGGTGAGAGG + Intergenic
985948543 5:3205094-3205116 GAGGAGAATTCCCAGGTGTGTGG - Intergenic
986491317 5:8293929-8293951 GAGGCGGAGTTTGCGGTGAGCGG - Intergenic
989439456 5:41453429-41453451 GTGGAGAAACTTCAGGTGAGTGG - Intronic
989688858 5:44117962-44117984 CAGGAGGCTTTTGAGGTGATCGG + Intergenic
994006262 5:94840906-94840928 GAGGTGGATTTTGGGGTGGGGGG + Intronic
994719185 5:103361340-103361362 TAGGAGGATTTTCCTGTGGGAGG + Intergenic
995215204 5:109587781-109587803 GAGGAGGCTATGCATGTGAGAGG - Intergenic
995593113 5:113720585-113720607 GAGGAGGAGTTTTTGGGGAGAGG + Intergenic
995667849 5:114564860-114564882 GACGTGGATGCTCAGGTGAGAGG - Intergenic
998590745 5:143475327-143475349 GATCAGCTTTTTCAGGTGAGAGG - Intergenic
998908263 5:146930173-146930195 CAGAAGGATTTTCAGAGGAGTGG + Intronic
999888513 5:155950868-155950890 AAGGAGGATTTTTAGGTGAGAGG - Intronic
1000885032 5:166740613-166740635 AAGGAAGATTTTGTGGTGAGGGG + Intergenic
1001319915 5:170672099-170672121 GAGGCAGAATTTCAGGTGAAAGG + Intronic
1002024120 5:176385213-176385235 GGGGAGGACTATAAGGTGAGCGG - Exonic
1003366925 6:5483782-5483804 GAAGAGGATGAGCAGGTGAGGGG + Intronic
1003399210 6:5778035-5778057 GAGGGAAATTTTCAGGTGATGGG + Intergenic
1004356645 6:14934994-14935016 GGTGAGGATTCTGAGGTGAGGGG - Intergenic
1005054509 6:21717149-21717171 GAGGTGGAGTTTGCGGTGAGCGG + Intergenic
1005782791 6:29210552-29210574 TAGGAGGCTTTTCAGGTGGCTGG + Intergenic
1006256318 6:32835451-32835473 AAGGAGGATGTTCAGAGGAGGGG - Intronic
1006287183 6:33105554-33105576 GGGGAGGATGGACAGGTGAGTGG + Intergenic
1006299861 6:33187946-33187968 GGGGAGGATTGACAGGTGGGTGG + Intronic
1006369763 6:33636633-33636655 GAGGAGCATGTTCCGGTGGGAGG + Intronic
1006878285 6:37317192-37317214 GAGGAGGATTTTCAGGTGAGTGG + Exonic
1007341530 6:41194079-41194101 GAGGAGGAAGGTCAGGTGAAAGG - Intronic
1011844351 6:91544614-91544636 GGGGAGGGTTGTCAGGGGAGGGG + Intergenic
1011890949 6:92159160-92159182 GGGAAGGATATTCAGGTCAGAGG + Intergenic
1012424174 6:99096013-99096035 GAGGAGGAGTTGGGGGTGAGAGG + Intergenic
1012850911 6:104446141-104446163 GTGGAGGGTGTCCAGGTGAGAGG + Intergenic
1014441455 6:121478593-121478615 GAGGCGGAGTTTGCGGTGAGCGG + Intergenic
1014894447 6:126884975-126884997 GAGGCGGATGTTGCGGTGAGTGG - Intergenic
1015106103 6:129539034-129539056 AAGGAGGATTTGGAGCTGAGAGG - Intergenic
1015398189 6:132758864-132758886 GAGGAGGAATCTCAGCTCAGGGG + Intronic
1016125575 6:140398790-140398812 GAGGAGGCTATTCATGTGTGGGG - Intergenic
1016140272 6:140600006-140600028 AAGGAGGATTTTCAAGAGGGTGG + Intergenic
1016410213 6:143775045-143775067 GAGCAGGATTTGGAGGTGGGGGG + Intronic
1016657918 6:146543308-146543330 GAGGTGGATTTCCAGGCCAGAGG + Intergenic
1016917595 6:149259199-149259221 GAGGATGTTTTTCAGGGAAGTGG + Intronic
1017295602 6:152790111-152790133 GAGGAGGATTTGCAGAAGAAAGG - Intergenic
1018084107 6:160287181-160287203 AAGGAAGATTTTCTGGTAAGGGG + Intergenic
1019796650 7:3054789-3054811 GATGGGGATTCTCATGTGAGTGG + Intergenic
1020869629 7:13611418-13611440 GAGGTGGAGTTTGAGGTGAGCGG - Intergenic
1022711575 7:32855626-32855648 GAGGAGGATTCCCAGCTGAGTGG - Intergenic
1022772443 7:33488454-33488476 AAGGAGGATGTTGATGTGAGGGG + Intronic
1022913080 7:34919332-34919354 GAGGAGGATTCCCAGCTGAGTGG + Intergenic
1024353784 7:48394230-48394252 GAGGAGGGTTTTGAGGTGGAAGG - Intronic
1026024291 7:66732453-66732475 GGGGAGACTTTCCAGGTGAGAGG + Intronic
1030309615 7:108056084-108056106 TGGGAAGATTTTCAGGAGAGAGG - Intronic
1031978188 7:128106921-128106943 GAGGAGGAGTTTGGGGTGGGGGG + Intergenic
1032882058 7:136100440-136100462 GAGGAGGAAGTCCAGGTGACAGG + Intergenic
1033191390 7:139283863-139283885 GAGAACCATTTCCAGGTGAGGGG - Exonic
1037607059 8:20447097-20447119 GAGGAAGATTCTCAGGTCCGGGG - Intergenic
1037632675 8:20672409-20672431 GAGGAGGATTTTAAGGTGACAGG - Intergenic
1038004120 8:23415809-23415831 GAGGAGGAAATTGAGGTGAGAGG + Intronic
1041253810 8:55961544-55961566 GATAAGGAGTTTGAGGTGAGTGG - Intronic
1041260698 8:56018718-56018740 GAGGAGGAATTTCTGCTGTGCGG + Intergenic
1041593784 8:59622327-59622349 GAGGAGGACATTCAGTTGAGAGG - Intergenic
1041793447 8:61721957-61721979 AAGGAGGATTTTCTGTTGATTGG - Intergenic
1041864920 8:62561103-62561125 GAGAAGGATATGGAGGTGAGGGG + Intronic
1042605938 8:70546622-70546644 GAGGGGGTTTTCCATGTGAGTGG + Intergenic
1042616806 8:70658699-70658721 GAGAAGGACTTGCAGGTAAGGGG + Intronic
1044613280 8:94115272-94115294 GAGGAGGGTTTGCAAGTGGGAGG - Intergenic
1045475671 8:102550296-102550318 GAGAAGACTTTTAAGGTGAGTGG + Intergenic
1045692237 8:104771850-104771872 GAGGAAGAATTTCAAGAGAGAGG - Intronic
1046339561 8:112835483-112835505 AAGGAGGATATTCAGGTGCTGGG - Intronic
1047287920 8:123504357-123504379 GAGGAGGATTTAAGGGGGAGTGG + Intronic
1047334496 8:123922640-123922662 GTGGAGGATTTCCAGGTTGGCGG - Intronic
1047802388 8:128323512-128323534 GAGAGGGATTTGCAGGTGACAGG - Intergenic
1049702855 8:144022983-144023005 GAAGAGGGTTTTCAGGGAAGAGG - Intronic
1049703340 8:144024732-144024754 AAGGAGGGTTTTCAGGGAAGAGG - Intronic
1051255166 9:15205678-15205700 GAAGAGGATATTCAGGTGACTGG - Intronic
1051902310 9:22056897-22056919 GAGCAGGATTTCCAGGAGGGAGG - Intergenic
1054804056 9:69381037-69381059 GAGGAGGATTCTCTGGTCAATGG + Intronic
1055632321 9:78236645-78236667 GAAGTGGGTTTTTAGGTGAGTGG + Intronic
1056926409 9:90838549-90838571 AAGGAGGGTTTTCAGGTGTCTGG - Intronic
1056983881 9:91343146-91343168 TAGGAGGATTTTCAACTGTGAGG + Intronic
1057453458 9:95186742-95186764 GAGGAGGCTTTTGAGGTTAGGGG + Intronic
1057474806 9:95389443-95389465 GAGGAGGCTTTTGAGGTTAGGGG - Intergenic
1057851477 9:98570115-98570137 AAGGAGGACTTTCAGATGGGAGG - Intronic
1058846967 9:108970409-108970431 GAGGAGACATTTCAGGTGACTGG - Exonic
1059111051 9:111558953-111558975 GAGGAGCATCTGCAGGAGAGGGG - Intronic
1060122311 9:121004700-121004722 GAGGAGGAGTTTGCAGTGAGCGG + Intronic
1060165320 9:121409018-121409040 GAGGACGACTTTCAGGTCATAGG - Intergenic
1061193367 9:129094774-129094796 GAAGAGGTGTTTCAGCTGAGAGG - Intergenic
1203630097 Un_KI270750v1:66245-66267 GAGGAGGAGCTTGTGGTGAGTGG + Intergenic
1187741707 X:22363139-22363161 GATGAGGATGATGAGGTGAGTGG + Intergenic
1188534232 X:31178595-31178617 AAGGAGGGTGTTCAGCTGAGAGG + Intronic
1190777151 X:53562103-53562125 GAGGAAGATGATCAGGTGAGGGG - Exonic
1191739931 X:64425716-64425738 GAGGGGGAAATTCAGATGAGTGG + Intergenic
1193307269 X:79963645-79963667 GAGGCGGAGGTTCCGGTGAGTGG + Intergenic
1195005393 X:100680622-100680644 GAAGAGCATTTTCAGAAGAGGGG - Intronic
1195398005 X:104431896-104431918 GACGAGGATTTTCGGGTCTGTGG - Intergenic
1197765450 X:130056923-130056945 GGGGAGGATTGTGAGGTGAGGGG + Exonic
1198219222 X:134584464-134584486 GTGAAGGATTTGCAAGTGAGTGG + Intronic
1198258487 X:134945862-134945884 GAGGAGGGCTTTCAGGTTATAGG - Intergenic
1198426461 X:136525752-136525774 GAGGAGGCCTGTCAGGTGAATGG - Intergenic
1198598838 X:138263910-138263932 AAGGAAGATTTTCTGGTAAGGGG - Intergenic
1198599008 X:138264925-138264947 AAGGAAGATTTTCTGGTAAGGGG + Intergenic
1198989729 X:142498212-142498234 GAGGATCATTTTCAGGCAAGAGG + Intergenic
1199092464 X:143707578-143707600 GAGGAGGAATTTAAGGGGAAGGG + Intergenic
1200777714 Y:7184298-7184320 GAAGAGGATTTGCTGGTGAGTGG + Intergenic
1200813330 Y:7506523-7506545 AAGAAAGATTTTCAGGTAAGGGG - Intergenic
1201060459 Y:10039617-10039639 GAGGTGGAGGTTGAGGTGAGCGG - Intergenic
1201682541 Y:16664264-16664286 GAGGAGCAGCTTCAGGTCAGTGG + Intergenic