ID: 1006881451

View in Genome Browser
Species Human (GRCh38)
Location 6:37343574-37343596
Sequence CTGTGGGTCAGGGATTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006881444_1006881451 0 Left 1006881444 6:37343551-37343573 CCATCGCATTACGTTCACCAACT No data
Right 1006881451 6:37343574-37343596 CTGTGGGTCAGGGATTCAGGTGG No data
1006881443_1006881451 4 Left 1006881443 6:37343547-37343569 CCAACCATCGCATTACGTTCACC No data
Right 1006881451 6:37343574-37343596 CTGTGGGTCAGGGATTCAGGTGG No data
1006881441_1006881451 29 Left 1006881441 6:37343522-37343544 CCACATCAAAACTAAGTGTCTTA No data
Right 1006881451 6:37343574-37343596 CTGTGGGTCAGGGATTCAGGTGG No data
1006881442_1006881451 5 Left 1006881442 6:37343546-37343568 CCCAACCATCGCATTACGTTCAC No data
Right 1006881451 6:37343574-37343596 CTGTGGGTCAGGGATTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006881451 Original CRISPR CTGTGGGTCAGGGATTCAGG TGG Intergenic
No off target data available for this crispr