ID: 1006884749

View in Genome Browser
Species Human (GRCh38)
Location 6:37371834-37371856
Sequence TAAGAGGCTCTCTGGGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006884749 Original CRISPR TAAGAGGCTCTCTGGGGAAG TGG Intronic
901306566 1:8237094-8237116 TAGGGGGGTCTCTGGGGAATGGG + Intergenic
901858815 1:12061603-12061625 GAAGTGGGTCTCTTGGGAAGGGG + Intergenic
902793808 1:18787286-18787308 GAAGGGGCTCTCTGGGGTGGTGG + Intergenic
903277165 1:22229467-22229489 TGTGAGGCCCTCTGGGAAAGTGG + Intergenic
903592893 1:24470647-24470669 TTAAAGGCTGTCTAGGGAAGTGG - Intronic
904401299 1:30258274-30258296 TAAAATGATCTCTGGAGAAGGGG - Intergenic
906238896 1:44229483-44229505 TAATTGGCTCTCTGGGGCAGCGG - Intronic
906992404 1:50753187-50753209 TTAGTGGTTCTCTAGGGAAGAGG - Intronic
907123447 1:52028189-52028211 AAAAAGCCTGTCTGGGGAAGTGG + Intronic
908026146 1:59953618-59953640 AAAGAGCCTCTGTGGGGAAGTGG + Intergenic
908064660 1:60389659-60389681 TAAAAGCCTCCCTGAGGAAGTGG - Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
910155306 1:84211010-84211032 TATGAGAATCTCTGGGGAAGAGG + Intronic
912401703 1:109398302-109398324 TAGGAGTGTCTCTGGGGAACAGG - Intergenic
912638296 1:111319550-111319572 AAAGAGGATCCCTGGGCAAGGGG - Intronic
912881371 1:113419535-113419557 TAAGAGGCTCTTTTGGGCTGGGG + Intronic
914320542 1:146555361-146555383 GCAGAGGCACTCTGGGGCAGTGG - Intergenic
915010217 1:152678548-152678570 TAAGAGGCTCTATTGGGATCAGG - Intergenic
915147963 1:153806501-153806523 CAAAAGGGTTTCTGGGGAAGGGG - Exonic
915538660 1:156553394-156553416 CATGAGGCTATCTGGGGCAGAGG - Intronic
916856616 1:168756734-168756756 GAAGAGCCTCTCATGGGAAGTGG - Intergenic
917031580 1:170698870-170698892 CAAGGGGGTCTCTGGAGAAGGGG + Intronic
918206342 1:182312828-182312850 TATGAGTCTCTTTGGGGCAGAGG + Intergenic
920650453 1:207833536-207833558 AAAGGGCCTCTCTAGGGAAGTGG - Intergenic
921257633 1:213356831-213356853 TAGGAGCCTGCCTGGGGAAGAGG + Intergenic
921882234 1:220268627-220268649 AAAGGGGCTCACTGGTGAAGAGG + Intronic
922809811 1:228409164-228409186 TAAGAGGCTTTCTAGGTAAGTGG - Exonic
923592120 1:235328255-235328277 TAAGAGGCCATCCGGGAAAGAGG - Intronic
923841557 1:237677689-237677711 AAAGAAGCTCACTGGGGAAGAGG - Intronic
1063223923 10:3996645-3996667 TTATAATCTCTCTGGGGAAGAGG - Intergenic
1065009368 10:21407692-21407714 AAAGTGGCTCTCAGTGGAAGGGG + Intergenic
1065613692 10:27499247-27499269 TAAGAGGCTTTGTGGGCAAAAGG - Intergenic
1065909106 10:30285986-30286008 CAAGTGGCTCTCGGTGGAAGGGG - Intergenic
1066323356 10:34327848-34327870 TAAGTGGGCCTCAGGGGAAGTGG - Intronic
1066390162 10:34971929-34971951 TAAGAGCTTCTCTGGGGACCGGG - Intergenic
1066477335 10:35760806-35760828 TAAGAGACACTCAGGGGAACAGG + Intergenic
1066585380 10:36928266-36928288 TTAAAGGCTGTCTGTGGAAGAGG + Intergenic
1068528688 10:58160549-58160571 TAAGAGGCTTTCAGTGCAAGTGG + Intergenic
1069822871 10:71238316-71238338 AAAGAGCCACTCTGGAGAAGTGG - Intronic
1069825680 10:71253737-71253759 TATGGGGATCTCTGGGGAGGAGG - Intronic
1070052188 10:72900149-72900171 TATGAGGCTCTCTCAAGAAGAGG + Intronic
1072158701 10:92746880-92746902 CAAGAGGCTCACTGGGGAGAGGG - Intergenic
1072788945 10:98303575-98303597 AAAGAGACTCTTTGGGGAGGGGG + Intergenic
1072890022 10:99315796-99315818 GAAGATGCTGTTTGGGGAAGAGG - Intergenic
1074156508 10:110804873-110804895 GAAGAGAATCTCTGGGCAAGAGG - Intronic
1074781168 10:116803372-116803394 CAAGAGACACTGTGGGGAAGAGG + Intergenic
1076517525 10:131056481-131056503 TGAGACGCCCTCTGTGGAAGAGG + Intergenic
1078355554 11:10629327-10629349 TCCTAGGCCCTCTGGGGAAGAGG - Intronic
1078729886 11:13964371-13964393 TCCAAGGCTCTCTGGGGAACTGG - Intronic
1078763621 11:14272638-14272660 TAATAGGCATTCTGGGGAAATGG - Intergenic
1078887818 11:15522907-15522929 TAGGAGGCTCTCTGAGAAAGGGG - Intergenic
1080633671 11:34104935-34104957 TAAAAGTGTATCTGGGGAAGGGG + Intergenic
1081390428 11:42522857-42522879 TAAGACCCACTTTGGGGAAGAGG - Intergenic
1081909835 11:46693897-46693919 TAAATGGCTCTCTGGAGAGGGGG - Intronic
1081977952 11:47247748-47247770 TAAGAGGGTCTAGAGGGAAGGGG + Intronic
1083935018 11:65865553-65865575 GAAGAGGCTTCCTGGAGAAGGGG + Intronic
1084766090 11:71309495-71309517 TCAGAGGCTCTCCGGGGAGGTGG + Intergenic
1084861721 11:72023110-72023132 TACCAGGCATTCTGGGGAAGAGG + Exonic
1085902759 11:80721607-80721629 TTAAAGGCTTTCTGTGGAAGAGG - Intergenic
1086749353 11:90471604-90471626 TAAGAGGGTCACTGGGGACGTGG + Intergenic
1087184106 11:95168537-95168559 TTATAGGCTCTTTGGGGATGAGG + Exonic
1088054463 11:105558313-105558335 TACAACTCTCTCTGGGGAAGAGG - Intergenic
1089104400 11:115990164-115990186 GAAGAGGCTCGCTGGGCATGGGG - Intergenic
1090254041 11:125270745-125270767 TCAGAGCCTCTCTGGGAAGGTGG - Intronic
1091815239 12:3432630-3432652 AGAAAGGCTCTCTGGGCAAGAGG + Intronic
1092185874 12:6478065-6478087 TATGAAGGTCGCTGGGGAAGAGG + Intergenic
1094095463 12:26699335-26699357 TGACTGGCTGTCTGGGGAAGTGG + Intronic
1094203472 12:27816529-27816551 TAAGTGTCTCTCTGGGGCTGGGG + Intergenic
1094701946 12:32878503-32878525 TATGAAGGTCGCTGGGGAAGAGG - Exonic
1096688580 12:53305578-53305600 CTAGAGGCTCTCTGTGGGAGTGG - Intronic
1097556193 12:61140558-61140580 TAACACACTCTCTGGTGAAGTGG - Intergenic
1097929655 12:65169931-65169953 CAGGAGGCTCTCTGGGCCAGAGG - Exonic
1098044873 12:66389971-66389993 TAAGGGGCTGTCAGGAGAAGAGG + Intronic
1101467530 12:104962938-104962960 TAAAAGGATCTCAGTGGAAGTGG + Intergenic
1102583601 12:113907967-113907989 CTAGGGCCTCTCTGGGGAAGTGG + Intronic
1102623417 12:114215154-114215176 TAAGCAGCTCTCAGGGGATGCGG - Intergenic
1104386463 12:128355508-128355530 TAAGAGGATCTCTGTGGTTGAGG - Intronic
1106404725 13:29463667-29463689 GAAGAGGCTCTGTGGTGAAGTGG - Intronic
1108112152 13:47086373-47086395 ACAGAGGCTTTCTGGGGAAAAGG - Intergenic
1108397085 13:49999751-49999773 TAACAGGCTCTCTAGTGAAGGGG - Intronic
1109595511 13:64548728-64548750 TAAGAGGCTCTCAGAGGAGAAGG - Intergenic
1112793989 13:103034186-103034208 AAATAGGTTTTCTGGGGAAGTGG + Intergenic
1113582850 13:111440898-111440920 TAAGAGGCTATAGGAGGAAGAGG - Intergenic
1116255622 14:42550841-42550863 GAAGAGTCACACTGGGGAAGGGG - Intergenic
1116928214 14:50663251-50663273 TAAGAGGATCTCTGGTGGACAGG + Intronic
1117521419 14:56555054-56555076 TAAGAGCCTTTCTGGGGGAGGGG - Intronic
1117987844 14:61406031-61406053 AATGAGAATCTCTGGGGAAGAGG + Intronic
1120493389 14:85204599-85204621 AAAGTGGCTCTCAGAGGAAGGGG - Intergenic
1120614694 14:86688831-86688853 AAAGTGGCTCTCAGTGGAAGGGG - Intergenic
1121782304 14:96629750-96629772 CAAGAGGAGCTCTGGGGAAGAGG + Intergenic
1122363549 14:101181571-101181593 AAAGAGGATGTGTGGGGAAGTGG + Intergenic
1122486015 14:102080538-102080560 TAAGAGTCCCTCTGGGGACTGGG - Intergenic
1122613739 14:103002737-103002759 TAAGGGGGTGTCTGGGGCAGAGG - Intronic
1122825213 14:104367450-104367472 TCAGGGGCTCTCTCGGGAGGTGG - Intergenic
1122886865 14:104714079-104714101 GAGGAGGCTTTCTGGGGAGGAGG + Intronic
1124609313 15:31197453-31197475 TAAGAGGGTCGCTGGGAAAAAGG + Intergenic
1125469921 15:39992850-39992872 TAAGAGGTTTTGTGGGGAAAAGG + Intronic
1127217882 15:56843873-56843895 TAACAGGCTCTCAGGGGAAGGGG + Intronic
1129079357 15:73025483-73025505 GATGAGGCTCTCTCGGGATGAGG - Intergenic
1129549887 15:76436973-76436995 TCAGAGGTTCACTGGAGAAGGGG + Intronic
1129710007 15:77816128-77816150 CAAGAGGCTCAGTGGGGGAGTGG - Intronic
1130895828 15:88169809-88169831 AAAGAGGCTTTCTGGGGACATGG - Intronic
1132659894 16:1056670-1056692 GAAGAGGCTCTCAGAGGGAGGGG + Intergenic
1132659949 16:1056837-1056859 GAAGAGGCTCTCAGTGGGAGGGG + Intergenic
1133722262 16:8506022-8506044 CAAGGAGCTCTCTAGGGAAGTGG + Intergenic
1134602325 16:15543101-15543123 GAAGTGGCTCTCAGTGGAAGGGG + Intronic
1136103344 16:28011272-28011294 TGGGAGGCTCTCTCGGGCAGTGG - Intronic
1138332178 16:56224035-56224057 TCTGAGGCTCAGTGGGGAAGCGG + Intronic
1138415360 16:56868374-56868396 TGAGTGCCCCTCTGGGGAAGAGG + Intronic
1140012992 16:71154745-71154767 GCAGAGGCACTCTGGGGCAGTGG + Intronic
1141265004 16:82488690-82488712 TAGGAGGCACTCTGGGGCTGTGG + Intergenic
1141779903 16:86152467-86152489 TAACAGGCTGTCGGGAGAAGGGG - Intergenic
1141869448 16:86774643-86774665 TAATCTCCTCTCTGGGGAAGAGG - Intergenic
1142050838 16:87957185-87957207 GAGGTGTCTCTCTGGGGAAGGGG + Intronic
1142051210 16:87959534-87959556 TAGCAGGCTCTCCGGGGAGGAGG + Intronic
1143751154 17:9028856-9028878 TAAATGGCTCTCTAGGGAACTGG + Intronic
1143873779 17:9976522-9976544 GCAGGGGCTCTCTGGGGAGGGGG - Intronic
1143950183 17:10626195-10626217 AGAGAGGCTCTCTGAGGATGGGG + Intergenic
1145063452 17:19746459-19746481 CAAGAGGCTGTCAGTGGAAGCGG + Intronic
1148487991 17:48003582-48003604 TCAGGGGCTCTTTGGGGAGGGGG - Intergenic
1149612790 17:57969935-57969957 TAAGTGCCTATCTTGGGAAGAGG + Intergenic
1150315304 17:64164025-64164047 TGAGAGGTTCTCTGGGAAAGGGG + Intronic
1151533196 17:74720871-74720893 GAAGTGGCTCTCAGTGGAAGGGG + Intronic
1153229869 18:2925280-2925302 TCAGGGGCTCTGTGGGGATGGGG + Exonic
1154208898 18:12362047-12362069 TAAGAACCTCTGTGGGGATGGGG + Intronic
1157351071 18:46886161-46886183 TAAGAGGGTCTGTAGGGTAGTGG - Intronic
1157958595 18:52126683-52126705 AAAGTGGCTCTCAGTGGAAGGGG - Intergenic
1158140031 18:54245734-54245756 TCAGTGGCTCTCTGGAGAAGGGG - Intergenic
1158745487 18:60195465-60195487 TCTGAGGCTCTCAGGGGAGGAGG - Intergenic
1159361006 18:67402458-67402480 TCAGATGCTCTCTGGGGAGGAGG + Intergenic
1160406610 18:78651032-78651054 TGAGAGCCTCTCTGGGCTAGTGG - Intergenic
1160896165 19:1402879-1402901 AGAGAGGCTGTCTGGGCAAGGGG - Intergenic
1163455085 19:17401816-17401838 AGAGAGACTCTCTGGGGGAGGGG + Intergenic
1165953694 19:39488976-39488998 AAAGAGGCTCCCTGGGCACGTGG + Intronic
924983099 2:240903-240925 TAAGAGGCTCCTAGGGGGAGAGG + Intronic
925079222 2:1049075-1049097 TGGGAGGCTGTTTGGGGAAGGGG - Intronic
925187590 2:1859850-1859872 TGAGAGGGGCTCTGGGAAAGGGG + Intronic
926418848 2:12677724-12677746 GGAAAGCCTCTCTGGGGAAGTGG - Intergenic
926735628 2:16071215-16071237 TATGAGGATCTCTGGGGTGGGGG + Intergenic
927134074 2:20083961-20083983 TAAGAAGCAGTCTGGGGATGAGG - Intergenic
927936986 2:27081704-27081726 TAAGAGGCACTCTGGGCAGGTGG + Intronic
928327966 2:30335043-30335065 AGAGAGGCTCTCTGTGGAAGGGG + Intergenic
929654240 2:43714775-43714797 TATGAGGCTCTCTGAGGAATGGG - Intronic
929844859 2:45513396-45513418 TAAGGGGCATTCTGGAGAAGAGG - Intronic
930972762 2:57417305-57417327 TCAGAGCTGCTCTGGGGAAGTGG - Intergenic
932730663 2:74219813-74219835 TAGGAGCCTGACTGGGGAAGTGG + Intronic
934638170 2:96009901-96009923 TATGAGGGGCTCTGGGCAAGAGG - Intergenic
934976145 2:98803898-98803920 TAAGAGGACTTCTGGGGCAGAGG + Intronic
935091440 2:99898694-99898716 CAAGAGGCTTCCTGGGGAATGGG - Intronic
936989955 2:118352655-118352677 TAAGAGGCCTTCTGGCTAAGTGG + Intergenic
937042558 2:118833753-118833775 CTAGAGGGTCTCTGGGGAAAGGG + Intergenic
937050186 2:118882260-118882282 GAAGAGGCTCTGTGGGGACGTGG - Intergenic
937854887 2:126665160-126665182 GAAGAATCTCTATGGGGAAGAGG + Intronic
938892570 2:135720355-135720377 TATGAAGCTCTCAGGAGAAGGGG + Intronic
940453641 2:153871521-153871543 TAAGAGGCTCCCTGGTGCATTGG + Intergenic
942081406 2:172402699-172402721 TAAGAGGCTCTGAGTGGAGGCGG - Intergenic
943139407 2:183960599-183960621 TACCAGGACCTCTGGGGAAGAGG + Intergenic
943782991 2:191845621-191845643 CAAGAGGCTATCTGGGGACAGGG - Intronic
946306283 2:218858805-218858827 TCAAAGGCTCCGTGGGGAAGAGG - Intergenic
946370817 2:219280240-219280262 AAAGAGGCTCTATGAGGAGGAGG + Intronic
947177510 2:227382696-227382718 TGAAAGGATCTCTGAGGAAGTGG - Intergenic
947634569 2:231673475-231673497 TAAGAGGATGGGTGGGGAAGGGG - Intergenic
948730783 2:239962531-239962553 GGAGAGGCTTTCTGGGGAGGAGG - Intronic
1168789022 20:563638-563660 TCAGTGGCTCTAGGGGGAAGGGG - Intergenic
1169204219 20:3731235-3731257 AAGGAGGCCCTCTGGGGCAGTGG + Intergenic
1170609789 20:17903125-17903147 TAAAAGCCTTTATGGGGAAGGGG + Intergenic
1171306048 20:24107258-24107280 AAAGTGGCTCTCTGGCTAAGAGG - Intergenic
1172201632 20:33131103-33131125 TAAGTGGGGCTCTGGGGATGTGG + Intergenic
1173923578 20:46764046-46764068 TAAGAGGCTCCCTGGGGCAAAGG + Intergenic
1173938311 20:46888167-46888189 TCAGGGTCTCTCTGGGGTAGAGG + Intergenic
1174202179 20:48814407-48814429 TAGAAGGCTCTCTGAGGAAGCGG + Intronic
1174475202 20:50791357-50791379 AAAGAGGAGGTCTGGGGAAGGGG - Intergenic
1175415842 20:58800495-58800517 CCAAAGGCCCTCTGGGGAAGAGG + Intergenic
1175568035 20:59996117-59996139 TAAGGGGCTTGCTGGGGTAGGGG + Intronic
1175593695 20:60213614-60213636 GAAGAGGCACTCGGGGGAGGAGG - Intergenic
1175882065 20:62265488-62265510 GAATGGGCTCCCTGGGGAAGTGG - Intronic
1177068749 21:16474204-16474226 AAAGAGGCTTTGTGGGGAAAAGG + Intergenic
1177801586 21:25833710-25833732 AAAATGGCTCTCAGGGGAAGGGG - Intergenic
1178085255 21:29105700-29105722 TTAGAAGCTCTGTGTGGAAGGGG + Intronic
1179655606 21:42842472-42842494 CAGGAGACTCCCTGGGGAAGAGG + Intergenic
1179985527 21:44918668-44918690 CAGGAGACTCCCTGGGGAAGAGG - Intronic
1181127733 22:20711626-20711648 ACAGGGGCTCTCTGTGGAAGTGG + Intronic
1181596226 22:23916692-23916714 TGAGAGGCCCACTGGTGAAGAGG + Intergenic
1182483077 22:30622303-30622325 TAAGAGGCTTCCTGTGGCAGTGG + Intronic
1182526150 22:30921500-30921522 TAAGAGAATATCGGGGGAAGGGG + Intergenic
1182985489 22:34712368-34712390 CATGAGGCTATCTGGGAAAGAGG - Intergenic
1183137913 22:35907551-35907573 TAAGATTCTGTGTGGGGAAGAGG + Intronic
1184514959 22:44956207-44956229 GAGGAGGCTCCCTGGGGAGGGGG + Intronic
1185023023 22:48391475-48391497 AAAGAGGTTCCCTGGTGAAGAGG + Intergenic
949755637 3:7407426-7407448 TAAGAGGCTTTCAAGGGTAGAGG + Intronic
951080010 3:18443324-18443346 TAAGGTTCTCTCTGGGGAATAGG + Intronic
951534653 3:23729713-23729735 GAAGTGGCTCTCTGCGGTAGAGG - Intergenic
952416027 3:33092373-33092395 CCAGAGCCTTTCTGGGGAAGGGG - Exonic
953007267 3:38990073-38990095 TCAGAGGCTCCCTGGGGATCAGG + Intergenic
955650219 3:61186275-61186297 GGAGAGACTCTCTGGGTAAGTGG - Intronic
956751309 3:72346126-72346148 CAAGAGTCTTTCTGGGGAAGCGG - Intergenic
957040142 3:75329995-75330017 TAAGAGGCCCTCTGGACAAAGGG + Intergenic
959877501 3:111402286-111402308 TAAGGGTATCTTTGGGGAAGAGG - Intronic
959946854 3:112134174-112134196 GAAGTGGCTCTCAGTGGAAGGGG - Intergenic
960355048 3:116641182-116641204 GAAGAGGCTATCTGTGGAACAGG + Intronic
961044931 3:123701538-123701560 CAAGAGGCCCTCTGGGCAAAGGG + Intronic
961135907 3:124511082-124511104 TAGGTGGCTCTGTGGGGATGAGG - Intronic
962673045 3:137728516-137728538 CAAGGGTCTGTCTGGGGAAGAGG - Intergenic
963009615 3:140756722-140756744 CAAGAGGCAGTGTGGGGAAGAGG + Intergenic
964403386 3:156322850-156322872 TAAGAGGCTCATTAGGCAAGAGG - Intronic
964883042 3:161445726-161445748 TATCAGGCTCCCTGTGGAAGAGG + Intergenic
965480311 3:169210728-169210750 GAAGGAGCTCTCTGGGGAGGTGG - Intronic
966160453 3:176962074-176962096 TAAGCAAATCTCTGGGGAAGAGG + Intergenic
968233178 3:197016111-197016133 GGCGAGGCTCTCTGGGAAAGTGG - Intronic
968712423 4:2128554-2128576 CAAGATGGTCTCTGGGGAAGAGG + Intronic
974003565 4:56534167-56534189 TAAGTGGTTCTCTAGAGAAGGGG - Intronic
974799767 4:66801811-66801833 TATGACCCACTCTGGGGAAGAGG - Intergenic
975707780 4:77128104-77128126 GAAGTGGCTCTCGGTGGAAGGGG + Intergenic
977404687 4:96581371-96581393 TTGGAAGCTCTTTGGGGAAGTGG - Intergenic
978605741 4:110476855-110476877 GAAGAGGCCCTCTGGGGACCAGG + Exonic
978964939 4:114729330-114729352 AAAGAGGCTCTGTGGGGGAAAGG + Intergenic
980137979 4:128878973-128878995 AAAGAGGCTCACTCGGGAGGGGG + Intronic
980907359 4:138961457-138961479 TGAGAGTCTCTATGGGGAAATGG - Intergenic
981176359 4:141688369-141688391 TAACAGCTTCTCTGGGGATGAGG + Intronic
981366457 4:143909598-143909620 TAAGAGGATCTCTGGTGGACAGG + Intergenic
981604747 4:146529055-146529077 TAAGAGCTTCTCTGGGGACCGGG - Intergenic
984682330 4:182624490-182624512 TGAGTGGCATTCTGGGGAAGTGG - Intronic
985980059 5:3455332-3455354 CAAGATGATCTCTGGAGAAGGGG - Intergenic
986094652 5:4542602-4542624 TAAGAGGCACCCTGGGCAAAGGG - Intergenic
986571589 5:9171188-9171210 TAAAACACGCTCTGGGGAAGGGG + Intronic
986947140 5:13036376-13036398 TACCAGGCATTCTGGGGAAGTGG + Intergenic
987490719 5:18577546-18577568 AAAGAGGCTGACTGGGGAAATGG + Intergenic
995284259 5:110368764-110368786 AAAGTGGCTCTCAGTGGAAGGGG + Intronic
996877148 5:128252267-128252289 TAAGGGGCTCTCTAGAAAAGTGG + Intergenic
997361152 5:133295844-133295866 TAAGAGCCTCTGATGGGAAGAGG - Intronic
997476647 5:134146356-134146378 TAAGCAGTTCTGTGGGGAAGCGG - Exonic
998590855 5:143476529-143476551 GAAGGGGCTCTCTAGTGAAGAGG + Intergenic
999531856 5:152472241-152472263 CATCAGGCTCTCTGGGGAGGTGG - Intergenic
999808818 5:155108825-155108847 TGAGAGGCTCTCTGAGTATGAGG + Intergenic
1000135857 5:158350171-158350193 AAAGAGGATCTGTGGGGGAGTGG + Intergenic
1001123269 5:168997236-168997258 TCAGAGGCTCCCTGGGGATTTGG + Intronic
1001147853 5:169200347-169200369 TAAGAAGCTGCCTGGGGAAGGGG - Intronic
1001646770 5:173287898-173287920 TAGGAGGCTCGCAGGGGATGAGG + Intergenic
1002956524 6:1870507-1870529 AAAGAGCCTCTCTGGTGATGTGG - Intronic
1003025822 6:2555063-2555085 TAAGATGCTCTTCGGGGAGGAGG - Intergenic
1003137762 6:3446228-3446250 TAAGGGCCACTCTGGGGCAGAGG + Intronic
1003387050 6:5678541-5678563 TAAGAGGCTATCTGCAGCAGTGG - Intronic
1003949652 6:11105789-11105811 TAACAGGCTCTCTGGGAATATGG - Intronic
1004016142 6:11733628-11733650 TTAGAGGCTGTCCGGGAAAGAGG - Intronic
1005415104 6:25591939-25591961 CAAAAGGTTCTCTGGGGATGTGG - Intronic
1006884749 6:37371834-37371856 TAAGAGGCTCTCTGGGGAAGTGG + Intronic
1007380535 6:41487843-41487865 TCAGAGGCACTCTGGGCAGGTGG - Intergenic
1007717729 6:43866993-43867015 TAAGAGACTTTTTGGGGAAATGG - Intergenic
1010778219 6:79910773-79910795 TAAAAGGGTCTCTTGGGCAGGGG + Intergenic
1011088165 6:83566188-83566210 TAAAAGGCTCTAAGGGTAAGGGG + Intronic
1011462575 6:87620172-87620194 TAAGGGGCTTGCTGCGGAAGAGG - Intronic
1015067992 6:129054183-129054205 TATGAGCCTCTCAGGGGAATAGG + Intronic
1015489436 6:133808885-133808907 GAAGAAGATCTCTGGGAAAGAGG + Intergenic
1021220093 7:17965602-17965624 TAAGGGGCTTTCTGAGGAAAAGG - Intergenic
1022533373 7:31080743-31080765 TAAGAGGCTCACTGGGTATCAGG + Intronic
1023014623 7:35955083-35955105 AGATAGGCTCTCTGGGAAAGCGG + Intergenic
1023089882 7:36607895-36607917 TGAGAGGCACTGTGGGGAACAGG + Intronic
1024005888 7:45224697-45224719 GAAGCTGCGCTCTGGGGAAGAGG - Intergenic
1026828389 7:73597359-73597381 GTAGAAGCTCTATGGGGAAGGGG + Exonic
1026958586 7:74394120-74394142 GATGAGGCCCTCTGGGAAAGAGG - Intronic
1029100830 7:98128698-98128720 CCAGGGGCTCCCTGGGGAAGAGG + Intronic
1029359944 7:100081454-100081476 TAGGGGGATCCCTGGGGAAGCGG + Intronic
1033408388 7:141092877-141092899 TATGGGGCTCTCTGAGGAAGAGG + Intronic
1033600652 7:142886095-142886117 GAAGAGGCACTGTGGGAAAGTGG - Intergenic
1033768907 7:144526236-144526258 TAATAGGCTCTCAGGAGGAGAGG + Intronic
1033981987 7:147176538-147176560 TAAAAGGCATTCTGGGAAAGAGG - Intronic
1034329493 7:150270079-150270101 AAAGAGGGCCACTGGGGAAGTGG + Intronic
1034346684 7:150389576-150389598 TATGAGTCTATCTGGGGAAAGGG - Intronic
1034425235 7:151010510-151010532 AAAGAGGCTCAGTGGGGGAGGGG + Intronic
1034668563 7:152839782-152839804 AAAGAGGGCCACTGGGGAAGTGG - Intronic
1035285677 7:157805193-157805215 TAAGAAGCACTGTGGGGGAGAGG - Intronic
1035355770 7:158275265-158275287 TCAGAGGCCCTCCGAGGAAGTGG - Intronic
1035813495 8:2513464-2513486 AAAGGGCCTCTCAGGGGAAGGGG + Intergenic
1036445618 8:8819702-8819724 CAAAAGGCTCTTTGGGGAAAAGG - Intronic
1036474126 8:9077670-9077692 TAAAAGTCTCTCTGAGCAAGAGG + Intronic
1036694668 8:10966744-10966766 GAATAGGGTCTCTGGGGATGGGG + Intronic
1037578365 8:20229209-20229231 TGAGAGGTCCTCTGGGTAAGTGG + Intergenic
1037916708 8:22777436-22777458 TAAGAGGGGCTGTGGGGAGGGGG + Intronic
1038316426 8:26488480-26488502 TAACAAGCTCTTTGGGGAAGTGG - Intronic
1040815168 8:51500014-51500036 CAAGAGGCTCCCTGGGAAAAGGG - Intronic
1043921964 8:85993394-85993416 AAAGAGGCTCTAATGGGAAGAGG - Intronic
1045009472 8:97944909-97944931 TAAGAGGTGCTTTGGGGAGGAGG - Intronic
1045029472 8:98121311-98121333 TTAGTGGCTCTCAGTGGAAGTGG + Intronic
1045295270 8:100867186-100867208 TAACACGCTCTCTGGGGACCTGG - Intergenic
1046815946 8:118583729-118583751 TAAAAGGCTTTCTGAAGAAGAGG - Intronic
1047698490 8:127427275-127427297 CAAGAGGCTCACTGGATAAGCGG - Intergenic
1047813443 8:128435608-128435630 TAGGAGGCCCACTGGGGAAAAGG - Intergenic
1047964380 8:130034910-130034932 TAAGTGGATCTCTGGATAAGCGG + Intergenic
1049618207 8:143585651-143585673 TGACAGGCTGGCTGGGGAAGGGG - Intronic
1051701186 9:19825849-19825871 TAAGAGGCTCACTCAGTAAGAGG + Intergenic
1052254086 9:26433134-26433156 TAGGAGGCCCTCTAGGAAAGGGG + Intergenic
1052820150 9:33132013-33132035 TAAGAGAGTAGCTGGGGAAGTGG + Intronic
1056161372 9:83898478-83898500 AGAGTGGCTCTCTGAGGAAGAGG + Intronic
1059498008 9:114726152-114726174 TGAGAGTGTCTCTGGGGATGAGG + Intergenic
1060102316 9:120851399-120851421 TCAGCTGCACTCTGGGGAAGAGG + Intergenic
1061266933 9:129511609-129511631 CAAGAGCTTCTCTGGGGAAAGGG + Intergenic
1061309882 9:129755234-129755256 TGAGAGGTGCCCTGGGGAAGTGG + Intergenic
1062105316 9:134752041-134752063 GAAGCGGCTCTGTGGGAAAGCGG + Intronic
1062224426 9:135441421-135441443 TAAGAGCTTCTCTGGGGACTGGG + Intergenic
1062412481 9:136432061-136432083 GGAGTGGCTCTCAGGGGAAGTGG + Intronic
1062628483 9:137453474-137453496 CAAGAGGCCCTCAGGGGCAGGGG - Intronic
1185668916 X:1790206-1790228 TAAAATGCTCTATGTGGAAGAGG - Intergenic
1186169474 X:6861719-6861741 CAAGAAGCTCACTGGGCAAGTGG + Intergenic
1186795662 X:13044481-13044503 CCAGAGGCCCTTTGGGGAAGAGG - Intronic
1187745302 X:22402970-22402992 CAAGAAGCTCTATGAGGAAGTGG + Intergenic
1189583469 X:42432067-42432089 TAAAAGGCTCTTTGCAGAAGTGG - Intergenic
1190330637 X:49233186-49233208 CTAGAGGCTCTCTGGGGGTGGGG + Intronic
1193430519 X:81397641-81397663 AAAGTGGCTGTCTGGGTAAGAGG + Intergenic
1194615878 X:96103157-96103179 TAACACGCCCTCTGGGGATGTGG - Intergenic
1199555130 X:149099405-149099427 GAAGAGGCTATTTGGGTAAGTGG + Intergenic
1200834615 Y:7721177-7721199 TAAGAGGCAATTTGGGGAATGGG - Intergenic
1201559806 Y:15304003-15304025 CAAGAAGCTGACTGGGGAAGTGG + Intergenic