ID: 1006893124

View in Genome Browser
Species Human (GRCh38)
Location 6:37446886-37446908
Sequence GTGCCATCCAGGTTCTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006893119_1006893124 -3 Left 1006893119 6:37446866-37446888 CCTTGTACTTCCCCAGGTTTGTG 0: 1
1: 0
2: 1
3: 13
4: 163
Right 1006893124 6:37446886-37446908 GTGCCATCCAGGTTCTAAATAGG No data
1006893117_1006893124 11 Left 1006893117 6:37446852-37446874 CCTTCTAAGAAGATCCTTGTACT 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1006893124 6:37446886-37446908 GTGCCATCCAGGTTCTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006893124 Original CRISPR GTGCCATCCAGGTTCTAAAT AGG Intronic
No off target data available for this crispr