ID: 1006896191

View in Genome Browser
Species Human (GRCh38)
Location 6:37472619-37472641
Sequence GAGCTAAGGCTGCCACAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006896178_1006896191 20 Left 1006896178 6:37472576-37472598 CCAGAGGGCTTGTGCAGATGCCC 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1006896191 6:37472619-37472641 GAGCTAAGGCTGCCACAGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 133
1006896187_1006896191 -4 Left 1006896187 6:37472600-37472622 CCATGGGCTCTAAGGGGCGGAGC 0: 1
1: 0
2: 1
3: 5
4: 105
Right 1006896191 6:37472619-37472641 GAGCTAAGGCTGCCACAGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 133
1006896185_1006896191 -1 Left 1006896185 6:37472597-37472619 CCACCATGGGCTCTAAGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1006896191 6:37472619-37472641 GAGCTAAGGCTGCCACAGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 133
1006896184_1006896191 0 Left 1006896184 6:37472596-37472618 CCCACCATGGGCTCTAAGGGGCG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1006896191 6:37472619-37472641 GAGCTAAGGCTGCCACAGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006896191 Original CRISPR GAGCTAAGGCTGCCACAGGT GGG Intronic
900294669 1:1942911-1942933 GAGATGAGGCTGCCACAGCATGG - Intronic
903447913 1:23434249-23434271 GAGCTTTGGTTGGCACAGGTGGG - Exonic
904024927 1:27496798-27496820 GAGCTGAGGATGCCAGAGGGAGG - Intergenic
905804170 1:40863860-40863882 GTCCCAAGGATGCCACAGGTCGG - Intergenic
907399957 1:54219061-54219083 GAGCGAAGGCAGCAGCAGGTGGG + Intronic
908544235 1:65148301-65148323 GAGCGGAGGGTGCCAGAGGTAGG + Exonic
913186311 1:116373380-116373402 GAGCTAGGGCTGCCGCGGGGCGG - Intronic
915355998 1:155255437-155255459 GAGCTCCGGCTGCCGCAGGTCGG + Intronic
918318075 1:183339844-183339866 GAGCTATGTCTGCCTCAGGTGGG + Intronic
920951088 1:210572467-210572489 CATCTAAGGTGGCCACAGGTGGG - Intronic
1066243317 10:33558578-33558600 GAGATGACGCTGCTACAGGTGGG - Intergenic
1066243872 10:33563270-33563292 GGGCCAAGGCTGCCTCATGTTGG - Intergenic
1067362165 10:45592781-45592803 GAGCTAAGGCTGCCAGATTTAGG + Intronic
1069946547 10:71990303-71990325 CAGGTAAGGACGCCACAGGTAGG - Intronic
1074077651 10:110143309-110143331 GAGCTAAGGCGGTCACTGGGAGG - Intergenic
1075426913 10:122349134-122349156 GAGCTAAGCAGGCCACAGCTGGG - Intergenic
1075657219 10:124169903-124169925 GGGCTGAGGGTACCACAGGTGGG - Intergenic
1079269876 11:18974333-18974355 GAGCAAAGGTGGCCTCAGGTAGG - Intergenic
1083148349 11:60774750-60774772 GAGCAAAGGCTGCCTCGGGCAGG + Intronic
1084068657 11:66719971-66719993 AAGCTATGGCTGCCACAAGGGGG + Intronic
1085402371 11:76242554-76242576 GAGCTGGGGGTGCAACAGGTGGG - Intergenic
1085926921 11:81034352-81034374 GAGGAAAGGCAGCCACAGCTGGG + Intergenic
1086559806 11:88154607-88154629 GATCTATGTCTGTCACAGGTGGG - Intronic
1089255168 11:117190305-117190327 GAGCTGAGGCTGCGGCAGGCAGG - Intronic
1090765374 11:129871682-129871704 GAGGCAAGGCTGCCGCAGATGGG - Intronic
1094064946 12:26352153-26352175 GAGCTCTAGCTGCCACAGGGAGG - Intronic
1094567882 12:31616524-31616546 GAGCGGAGGGTGCCAGAGGTAGG - Intergenic
1096088767 12:48884122-48884144 GAGCGTGGGCTCCCACAGGTGGG + Intergenic
1096737761 12:53669210-53669232 GAGCTGGGGCTGCCACAGTTGGG - Exonic
1098302063 12:69064434-69064456 GTGCCAAGGCTGCCCCAGGAGGG + Intergenic
1103161643 12:118734186-118734208 GAGCTCTGAGTGCCACAGGTGGG + Intergenic
1105657832 13:22459509-22459531 GAGGTAAGGCTAACAAAGGTGGG - Intergenic
1105842338 13:24265635-24265657 GAACCAAGGCTGCCACGGGCTGG - Intronic
1107274046 13:38656864-38656886 GAGATAAGACTGCCAGAGGCTGG - Intergenic
1112922621 13:104634282-104634304 GAGCTATGGTGGCCACAGATGGG + Intergenic
1114447272 14:22798576-22798598 GAGTTAAGCCTGCCTTAGGTTGG - Intronic
1119983794 14:79113011-79113033 GAGCTGAGGCTGAGAAAGGTCGG - Intronic
1125039585 15:35169316-35169338 AAACTAAAGCTGCCACAGGATGG + Intergenic
1128235577 15:66065105-66065127 AAGCAAATGCTGCCACGGGTGGG + Intronic
1129879907 15:78999613-78999635 GTGCTAAGGATGGCACAGGTGGG - Intronic
1130092061 15:80829376-80829398 GAGCTAAGGGTGGCAGAGGCAGG - Intronic
1131153721 15:90062400-90062422 GAGCTCAGACTGCCCCAGGCTGG - Intronic
1131154366 15:90065581-90065603 GGGAAAAGGCTGCCCCAGGTGGG + Intronic
1132296552 15:100738893-100738915 GAGCAAAGGCTCCCACGGCTGGG - Intergenic
1135055936 16:19232109-19232131 GAGCTAAAACTGCCAGGGGTTGG + Intronic
1138377529 16:56576165-56576187 GAGCCAGGGCTTCCAGAGGTGGG - Intergenic
1142065490 16:88059957-88059979 GGGCTGAGGTTGGCACAGGTGGG + Intronic
1144261593 17:13527105-13527127 GAGCTGAGGCTGCTATACGTGGG + Intronic
1145039658 17:19567825-19567847 GAGCTAAGGCTGCACAAGGAGGG - Intronic
1146251146 17:31345412-31345434 GAGCGGAGGGTGCCAGAGGTAGG + Intronic
1151241132 17:72758767-72758789 CAGCTGTGGCTTCCACAGGTGGG - Intronic
1151480763 17:74369001-74369023 GTGGTAAGGCTGCCACAGACAGG - Intronic
1151581125 17:74979606-74979628 GAGTGGAGGCTGCTACAGGTGGG - Intergenic
1152135576 17:78501387-78501409 GAGCTAGGGCTGCCTAAGGAAGG + Intronic
1152307020 17:79527040-79527062 GAGCTCAGGCTGCCCAGGGTGGG - Intergenic
1153463421 18:5362673-5362695 GAGCAAAGGCAGACACAGCTGGG - Intergenic
1155057034 18:22194147-22194169 GAGCTTGGGCTGCTACAGATTGG - Intronic
1155750992 18:29422204-29422226 GAGGAAAGGCGGCCACAGTTGGG - Intergenic
1156561179 18:38127530-38127552 GTGCTAAGGCTCCTTCAGGTGGG - Intergenic
1159884776 18:73893539-73893561 GAGCCAAGACTGACACAGGTTGG + Intergenic
1160403126 18:78625636-78625658 GAGCGAAGGCTCCCCTAGGTCGG - Intergenic
1162424565 19:10586775-10586797 GAGGCAAGGCAGCCACAGATGGG + Intronic
1162547411 19:11339133-11339155 GAGCTAAGGCTGGGGGAGGTGGG - Intronic
1163570767 19:18080993-18081015 GAGCTAAGGCTGCAGCAGGAAGG + Exonic
1167017135 19:46848661-46848683 GAGAGAAGGCTCCCACAAGTTGG - Intronic
1167448731 19:49554955-49554977 CCCCTCAGGCTGCCACAGGTGGG + Intergenic
1168427776 19:56252844-56252866 GTGGTAAGGCAGCCACAGGCAGG + Intronic
1168641653 19:58034859-58034881 GAGCTTAGGATGCCACACGGAGG - Intronic
926647679 2:15307078-15307100 AAGCTATGGCTGTGACAGGTGGG + Intronic
927679450 2:25130267-25130289 CAGCAAAAGCTGCCACAGGGTGG + Intronic
927893716 2:26768177-26768199 GAGTTAAGGCTTCCACAAGCTGG - Intronic
929770285 2:44885960-44885982 CAACTAAGGCTGCCACATGCAGG - Intergenic
933729685 2:85447271-85447293 GAGCTCAGGCTGGCATCGGTAGG + Intergenic
933844485 2:86314442-86314464 GAGCTAAGGCAGGCCCAGGTGGG + Intronic
935573484 2:104686916-104686938 TTGTCAAGGCTGCCACAGGTTGG - Intergenic
935856558 2:107280973-107280995 GGGCTAAGCCTTCCACATGTGGG + Intergenic
946760120 2:222985170-222985192 AGGCTAAAGCTGCCACAGGGAGG + Intergenic
947529349 2:230898953-230898975 GGACTGAGGCTGCCACAGGAGGG - Intergenic
948243208 2:236455943-236455965 GAGCAAGGGCTGCCAGTGGTGGG - Intronic
948737586 2:240019269-240019291 GAGCTAAGGGCGCCACAGGGAGG - Intronic
948978313 2:241478331-241478353 GCCCTAAGGCTGCCCCAGGCAGG - Intronic
949036697 2:241818741-241818763 GGGCTGAGGCTGCCTGAGGTGGG - Intergenic
1169051154 20:2578973-2578995 GAGCCCAGGCTGCCAGAGGCAGG - Intronic
1169768873 20:9179657-9179679 GAGTTAAGTATGCCAAAGGTTGG + Intronic
1172294217 20:33796904-33796926 TAGCTGAGGGTGCCTCAGGTAGG + Intergenic
1172606987 20:36220711-36220733 GAGCTCAGGCAGCAAGAGGTAGG + Intronic
1174412491 20:50344985-50345007 GAGATGCGGCTGTCACAGGTGGG - Intergenic
1175068143 20:56308051-56308073 CAGCTAGGGTTGCCACAGGCTGG - Intergenic
1180096685 21:45558610-45558632 GAGCGAGGGCAGGCACAGGTAGG + Intergenic
1180905349 22:19406753-19406775 GAGCAGAGGCTGCCCCAGGTGGG + Intronic
1184593264 22:45499847-45499869 GAGCCAAGCCTGCAACAGCTGGG - Intergenic
949474485 3:4430750-4430772 GAGCTATGGGAGCCAAAGGTGGG + Intronic
951806542 3:26650470-26650492 GACCTCAGTCTGCCACTGGTGGG - Intronic
952139823 3:30466106-30466128 GTACCAAGACTGCCACAGGTAGG - Intergenic
956367486 3:68520286-68520308 GATTTCAGCCTGCCACAGGTAGG + Intronic
962850146 3:139302158-139302180 GAGCTCAGGCTTCCACATGATGG - Intronic
962973038 3:140422724-140422746 GAGCTCAGGCTCCCTGAGGTTGG - Intronic
967890322 3:194360144-194360166 GAGCCAAAGCTCCCGCAGGTTGG + Exonic
968539604 4:1157989-1158011 AAGCTATAGCTGCCACAGATAGG - Intergenic
969375599 4:6761413-6761435 GAGCCCAGGCTGCCACGGGTTGG - Intergenic
969671292 4:8591804-8591826 GAACTAAGCCTGCCACAGCAGGG + Intronic
970589620 4:17547893-17547915 GTGCTAGGGCTGCCACAGACTGG - Intergenic
977665559 4:99643541-99643563 GAGCTGTGGCTCCCAGAGGTAGG - Intronic
978579062 4:110214423-110214445 GAGCCAAGGATGCCAATGGTGGG + Intergenic
982121561 4:152148244-152148266 GTGCCAAGGCTAACACAGGTGGG + Intergenic
983631064 4:169849768-169849790 GAGCTAAGGCCCTCACAGGAAGG + Intergenic
985575132 5:670368-670390 GTCCAGAGGCTGCCACAGGTGGG + Intronic
988984417 5:36602904-36602926 GAGCCAAGGCTGCCTCCTGTAGG - Intergenic
993904299 5:93605645-93605667 GAGGTAAGGCCGCCATAGGGTGG + Intergenic
995052952 5:107727127-107727149 AAGATCAGGTTGCCACAGGTTGG + Intergenic
997239062 5:132293999-132294021 GAGCTTAGGCTGCCACGCGTGGG - Intronic
999145462 5:149390299-149390321 GATCTAAGGAGGCAACAGGTGGG + Intronic
1005809015 6:29502229-29502251 CAGCTGAGGCTCCCACAAGTAGG - Intergenic
1006896191 6:37472619-37472641 GAGCTAAGGCTGCCACAGGTGGG + Intronic
1007244206 6:40448330-40448352 TATCTGAGGCTGCCAGAGGTGGG - Intronic
1007501630 6:42302759-42302781 GAGCTAAGCATGGCACGGGTGGG + Intronic
1018733614 6:166671345-166671367 GACCCAATGCAGCCACAGGTTGG - Intronic
1018900094 6:168046929-168046951 GAGCTTAGGGGGCCACAGGTGGG + Intergenic
1020017157 7:4837911-4837933 GAGGAAAGGCCGCCACAGATGGG - Intronic
1025020648 7:55476794-55476816 GGGCCAAGCCTGCCACAGCTTGG - Intronic
1025962064 7:66231525-66231547 CAGCTAAGGCTGGCACTGCTGGG + Intronic
1026845569 7:73697204-73697226 GAGCTTAGGGTCCCACAGCTTGG - Intronic
1029620777 7:101688649-101688671 GGGCTAAGGATGCCAGGGGTGGG - Intergenic
1031920398 7:127595949-127595971 GACCTGAGGCTGACCCAGGTTGG - Exonic
1032205998 7:129866046-129866068 GGGCACAGGCTGCCTCAGGTGGG - Intronic
1036914988 8:12796470-12796492 CAGCTAAGGCTGGCACTGCTCGG - Intergenic
1037139372 8:15501894-15501916 GAACTAAGGTGGACACAGGTAGG - Intronic
1040295456 8:46146740-46146762 GAGATAGGGCTGTCACAGGTGGG - Intergenic
1040530286 8:48261057-48261079 GAGCTGAGCCTGGCACAGGTGGG + Intergenic
1044299966 8:90572494-90572516 TAGGTAAGTTTGCCACAGGTTGG + Intergenic
1044942157 8:97354295-97354317 GAGCTAAGGCTGGCAGAGAAAGG - Intergenic
1048442436 8:134469832-134469854 GAGGTTGGGATGCCACAGGTAGG + Intergenic
1049283068 8:141760393-141760415 AGGCTGAGGCTGCCACAGGGTGG + Intergenic
1049425053 8:142534249-142534271 GATCTCTGGCTGCCACAGGAAGG + Intronic
1049694675 8:143977392-143977414 CAGCTCAGGCGGCCACAGTTGGG + Exonic
1051186930 9:14470182-14470204 GAGCAATGCCTGGCACAGGTTGG + Intergenic
1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG + Intronic
1059310820 9:113388038-113388060 GAGCTGAGGGTGGCAAAGGTGGG + Exonic
1061960292 9:133984719-133984741 GAGATAAGGCTTCGACACGTTGG - Intronic
1062125018 9:134855568-134855590 GAGCTGAGGCAGACACAGGCAGG - Intergenic
1185868225 X:3641355-3641377 GAGCTCAGGGGGGCACAGGTTGG - Intronic
1186841587 X:13489651-13489673 GAGCTAAGCCTGCCTCTGGGTGG - Intergenic
1189198789 X:39174296-39174318 CAGCTAGGGCTGCCACAGCCAGG + Intergenic
1189551562 X:42098928-42098950 GAGCTGGGGCTGCCGCAGTTGGG - Intergenic
1191615107 X:63162387-63162409 AAACTCAGGCTGCCACAGCTGGG + Intergenic
1191621191 X:63216536-63216558 AAACTCAGGCTGCCACAGCTGGG - Intergenic
1192718076 X:73664459-73664481 GAGGAAAGGCAGCCACAGTTGGG - Intronic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1195161955 X:102179920-102179942 GAGGAAAGGCAGCCACAGTTGGG - Intergenic
1199421553 X:147650280-147650302 GAGCCAAGGCTGGAACAGCTGGG - Intergenic
1202067890 Y:20959939-20959961 GAGCAAAGGCTGCCACCAGCTGG + Intergenic