ID: 1006897050

View in Genome Browser
Species Human (GRCh38)
Location 6:37477898-37477920
Sequence TAGTTACGATGGGCCCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006897045_1006897050 24 Left 1006897045 6:37477851-37477873 CCAGGCGGGCTGTGTCAGGCAGA 0: 1
1: 0
2: 0
3: 6
4: 207
Right 1006897050 6:37477898-37477920 TAGTTACGATGGGCCCTGCGAGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006897050 Original CRISPR TAGTTACGATGGGCCCTGCG AGG Intronic
901048351 1:6412709-6412731 TGGTTAAGATGGGCCGGGCGCGG - Intronic
902061356 1:13646112-13646134 GAGGTACGATGGGCCGGGCGCGG + Intergenic
902180154 1:14681974-14681996 TAGTTAAAATGGGCCGGGCGCGG - Intronic
903532772 1:24044522-24044544 TAGTTAAAATGGGCCGGGCGTGG - Intergenic
903804623 1:25996374-25996396 TAGTAACTATGGGCCGGGCGCGG + Intronic
912306628 1:108574458-108574480 TGGTTAAGATGGGCCAGGCGTGG + Intronic
1062860017 10:803653-803675 AAGTTGGGAGGGGCCCTGCGTGG - Intergenic
1064971236 10:21069177-21069199 TAGTTATGATGGGCCAGGTGTGG - Intronic
1069752878 10:70755552-70755574 TAGTTAAGATGGGCTGGGCGCGG + Intronic
1076525781 10:131111716-131111738 TAGTTATCTTGGGGCCTGCGTGG + Intronic
1083188525 11:61032852-61032874 TGGTTACGATGGGCCAGGCATGG + Intergenic
1087212757 11:95460384-95460406 AAGTTACGCTGGGCTCTGAGTGG - Intergenic
1089745220 11:120611999-120612021 AAGTTACAATCGGCCCTGCAAGG - Intronic
1091905087 12:4179205-4179227 TAATTATAATGTGCCCTGCGTGG - Intergenic
1102125351 12:110476026-110476048 TAGTTAAGATAGGCCAGGCGTGG - Intronic
1103785725 12:123431531-123431553 TAGTTAAGATGGGCCGGGCACGG + Intronic
1104853549 12:131890912-131890934 TGGTTAAGATGGGCCGGGCGCGG + Intergenic
1105370819 13:19800358-19800380 TAGTTAAGATGGGCTGGGCGTGG - Intergenic
1114369295 14:22068108-22068130 TAGTTACTATTGGCACTGTGAGG - Intergenic
1125388805 15:39169578-39169600 TAGTTACAATGGTCCTTGCTGGG + Intergenic
1137616079 16:49847830-49847852 TGGTTAAGATGGGCCATGCAAGG + Intronic
1144366103 17:14546300-14546322 TAGTTAAAATGGGCCAGGCGTGG - Intergenic
1146813405 17:35922836-35922858 TAGTAAAAATGGGCCCTGCCAGG - Intronic
1150303910 17:64068321-64068343 TAGGTACTATGGCCCCTCCGTGG - Intronic
1151979443 17:77499849-77499871 TCGTTACCATGGGCTCTGAGGGG - Exonic
1160530604 18:79560167-79560189 TCGGTCCGCTGGGCCCTGCGTGG + Intergenic
927869821 2:26616375-26616397 TGGTGACCTTGGGCCCTGCGAGG + Intronic
932728475 2:74199569-74199591 TGGTTAAGATGGGCCGGGCGTGG + Intronic
937901097 2:127019765-127019787 TAGTTAAGATTGGCTCTGGGAGG + Intergenic
940847283 2:158655839-158655861 TAGTCACGCTGGGCCCTGATGGG - Intronic
943683871 2:190796277-190796299 TAGTTATGATGGTCTCTGGGAGG - Intergenic
944859844 2:203804911-203804933 GAGTTACTATGGGCAGTGCGTGG + Intergenic
1174976339 20:55339687-55339709 TAGTTACACTGGGCCAGGCGTGG - Intergenic
1175707159 20:61188245-61188267 TAGTTGCCATGGCCCCTGCTCGG + Intergenic
1178120145 21:29461217-29461239 GAGTTACCATGGGCCGGGCGCGG - Intronic
1178336347 21:31746979-31747001 TAGATACGATGGGCCGGGCACGG - Intergenic
1184867523 22:47209796-47209818 TGGTGACGATGGGTCCTGTGGGG + Intergenic
950284754 3:11735894-11735916 CAGCCACGCTGGGCCCTGCGTGG - Intergenic
951562957 3:23986636-23986658 TGGTTAAGATGGGCCAGGCGCGG + Intergenic
974029803 4:56766250-56766272 TTGTTAAGATGGGCCAGGCGCGG + Intergenic
1002121195 5:177006226-177006248 GCGTTCCGAGGGGCCCTGCGTGG + Intronic
1002389454 5:178898274-178898296 CAGTTAATATGGGCCATGCGCGG - Intronic
1006897050 6:37477898-37477920 TAGTTACGATGGGCCCTGCGAGG + Intronic
1008316850 6:50054217-50054239 TAGTTATGATGGGATCTGCCTGG - Intergenic
1019689415 7:2402247-2402269 TGGTTAAGATGGGCCGGGCGCGG + Intergenic
1020962565 7:14824172-14824194 TAGTTACCATGTGTCCTGGGAGG - Intronic
1026127482 7:67591959-67591981 AAGTTACCATGGGCCGGGCGCGG - Intergenic
1033590409 7:142803909-142803931 GTGTTACCATGGGCCCTGCCTGG - Intergenic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1040450298 8:47539404-47539426 CAGGTAGGATGGGCCCTGTGTGG - Intronic
1041250406 8:55928434-55928456 AAGCAACAATGGGCCCTGCGTGG - Intronic
1048310350 8:133317512-133317534 TAGTTATTATGGGCCGGGCGCGG - Intergenic
1052849454 9:33367941-33367963 TAGTTACTCTGGGCCGGGCGCGG + Intronic
1060660264 9:125401240-125401262 TAGTTACTGTGGGCCCTGCAAGG + Intergenic
1061354369 9:130093053-130093075 TAGTGACGATGAGCACTGCCTGG + Intronic
1188684506 X:33053303-33053325 TAGTTACTGTGGGCCGGGCGCGG + Intronic