ID: 1006906211

View in Genome Browser
Species Human (GRCh38)
Location 6:37535562-37535584
Sequence ACAGCTTTTGCGCTTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006906210_1006906211 3 Left 1006906210 6:37535536-37535558 CCAGGAGCAGAGCACAGAGGGAC 0: 1
1: 0
2: 4
3: 38
4: 393
Right 1006906211 6:37535562-37535584 ACAGCTTTTGCGCTTCCAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 82
1006906207_1006906211 15 Left 1006906207 6:37535524-37535546 CCTTCTAGGTCACCAGGAGCAGA 0: 1
1: 0
2: 2
3: 14
4: 163
Right 1006906211 6:37535562-37535584 ACAGCTTTTGCGCTTCCAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006906211 Original CRISPR ACAGCTTTTGCGCTTCCAGC TGG Intergenic
902637352 1:17743342-17743364 GCAGCTTCTGAGCTCCCAGCAGG - Intergenic
906933083 1:50188690-50188712 ACAGAATGTGTGCTTCCAGCTGG + Intronic
908901853 1:68964821-68964843 ACAGCTTCTGACCTACCAGCTGG - Intergenic
912176978 1:107171396-107171418 ACAGCTTTTTCTCTTCCTCCTGG + Intronic
912623623 1:111190191-111190213 ACAGCTTTGGGCCTTCCAGCAGG + Intronic
916780572 1:168023533-168023555 ACAGCTTTTGAGCTTACCTCTGG - Intronic
1063765255 10:9132598-9132620 ACAGGGGTTGTGCTTCCAGCTGG + Intergenic
1068902463 10:62284235-62284257 ACAGCTTTTAGGCTCACAGCTGG - Intergenic
1069171161 10:65231261-65231283 CCAGCTTTTTCATTTCCAGCTGG + Intergenic
1074527697 10:114276315-114276337 ACAGGCTGTGCGTTTCCAGCAGG - Intronic
1075484011 10:122806038-122806060 ACAGATTTTGCCCTTACACCTGG + Intergenic
1079148240 11:17873919-17873941 CCAGCTGTTGTGCTTCCACCAGG - Intronic
1080159566 11:29157091-29157113 ATAGCTTTTATGCTCCCAGCAGG - Intergenic
1083318206 11:61828945-61828967 ACGGCTTTGGCGCCCCCAGCGGG + Intronic
1084492500 11:69486467-69486489 ACGGCTTTTGCGCCTTCACCTGG - Intergenic
1094650258 12:32369357-32369379 ACAGCTGTTGCCCTTCTACCAGG + Intronic
1096523419 12:52196867-52196889 ACAGCTCTTGCTCTTCCTTCAGG - Intergenic
1097890926 12:64777150-64777172 CCAGCTTTTGCCCTTTCAGTAGG - Intergenic
1106306486 13:28515629-28515651 AAAAATTCTGCGCTTCCAGCAGG - Intergenic
1109147983 13:58806538-58806560 ACAGCTGATGGCCTTCCAGCAGG + Intergenic
1109215021 13:59579752-59579774 ACATCTTTTGCAATTCCATCTGG + Intergenic
1111645961 13:91032247-91032269 ACAGCATTTGCTCTTGCTGCAGG + Intergenic
1115467613 14:33732885-33732907 ACAGCATGGGTGCTTCCAGCTGG - Intronic
1116012347 14:39366419-39366441 ACAACTTTTGAGTTTCCAGGTGG + Intronic
1116966550 14:51021286-51021308 ACAGCTTTGCCGATTCCTGCAGG + Intronic
1121027405 14:90626694-90626716 CCAGCTTATGGGCTGCCAGCTGG + Intronic
1122488240 14:102095827-102095849 ACACCATTTCCACTTCCAGCTGG + Intronic
1126267369 15:46770275-46770297 AAAGGGTTTGCGTTTCCAGCAGG + Intergenic
1128176305 15:65559088-65559110 ACAGCCTTTGAGATTTCAGCTGG - Intronic
1133809694 16:9151829-9151851 ACAGCTGCTGCGCTTCCTGTTGG - Intergenic
1143986203 17:10916543-10916565 AAAGGCTTTGCGTTTCCAGCAGG - Intergenic
1144878108 17:18412971-18412993 TCAACTTTTGCTCTTCCAGTTGG + Intergenic
1145154122 17:20531454-20531476 TCAACTTTTGCTCTTCCAGTTGG - Intergenic
1145283377 17:21485198-21485220 TCAGGTTTTGCACTTTCAGCAGG - Intergenic
1145394109 17:22480632-22480654 TCAGGTTTTGCACTTTCAGCAGG + Intergenic
1151364825 17:73610343-73610365 GCAGCTTTTGAGCTTGGAGCAGG - Intronic
1152840318 17:82563307-82563329 GCACCTTTTGCTGTTCCAGCCGG - Intronic
1154366968 18:13720106-13720128 ACAGCTTTTGGGCTTGCTACTGG - Intronic
1158949125 18:62475505-62475527 ACTGCTTTAGCCATTCCAGCTGG + Intergenic
1165076042 19:33280544-33280566 ACAGCTCTTGGTTTTCCAGCAGG - Intergenic
925023221 2:588004-588026 ACAGCTGTGGGGCTTCCAGGAGG + Intergenic
926169919 2:10546547-10546569 ACAGCCTTTGCTGTTGCAGCCGG + Intergenic
941701687 2:168610317-168610339 ACAGCTGTTGCCCATCCATCGGG + Intronic
942689682 2:178572300-178572322 ACAGATTCTGCGGTTTCAGCAGG + Exonic
947011909 2:225575232-225575254 ACAGCTTTAGAGCTTACAGCTGG + Intronic
1173218973 20:41115732-41115754 ACAGGTTTTGGGTCTCCAGCAGG - Intronic
1178202680 21:30425715-30425737 ACAGCTGTTGGGCCTCCAGCAGG + Exonic
1178972408 21:37192583-37192605 ACTGCTTTTGTGATTCAAGCAGG + Intronic
1179563754 21:42233828-42233850 TCAGGTTCTGCCCTTCCAGCGGG - Intronic
1180910114 22:19444028-19444050 ACCGCTTTAGAGCTTCCAGGAGG - Exonic
949954783 3:9258811-9258833 ACAGCTTTAGAGCTCCCTGCTGG + Intronic
952224605 3:31362504-31362526 ATAGCTTCTGCTCTTCCATCTGG - Intergenic
959131577 3:102363076-102363098 ACACCACTTGCACTTCCAGCTGG + Intronic
959980081 3:112506453-112506475 ACAGCTTTTGAGCACACAGCTGG - Intergenic
959991855 3:112639329-112639351 ACAGATTGTGCTCTTCCACCAGG - Exonic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
986007039 5:3677072-3677094 TCACCTTTTGAGCTACCAGCAGG + Intergenic
986739537 5:10694033-10694055 ACAGCCCTTGCGCTTCCTCCCGG - Intronic
991291072 5:65034607-65034629 ACAGCATTTGCTCTTGCAACAGG - Intergenic
992680166 5:79145179-79145201 AGGGCTTTAGGGCTTCCAGCTGG - Intronic
993318726 5:86445015-86445037 ACAGATTTAGCGCTTCCATGTGG - Intergenic
994574881 5:101565609-101565631 ACAGCTTTTGCCCATTCAGTAGG + Intergenic
999894879 5:156021298-156021320 ACAGGTGCTGTGCTTCCAGCTGG + Intronic
1002357441 5:178642210-178642232 GCAGCATTTGCACTTCCTGCAGG + Intergenic
1003797103 6:9616755-9616777 ACAGGTTTTGTGCCTCCAGATGG - Intronic
1004541186 6:16551767-16551789 CCTGCTGTGGCGCTTCCAGCTGG + Intronic
1006600554 6:35222667-35222689 ACAGCTTTTGGGTTCCCAACTGG + Intronic
1006906211 6:37535562-37535584 ACAGCTTTTGCGCTTCCAGCTGG + Intergenic
1010727894 6:79355988-79356010 CCAGCTTTTTCTCTTCCAGAAGG - Intergenic
1011266813 6:85529674-85529696 ACAGGCTTTGCTCTTACAGCAGG + Intronic
1014551020 6:122789640-122789662 ACAGCGTTAGGGCGTCCAGCCGG + Intronic
1019345498 7:528008-528030 TCAGCTTTTGAGCTGCCTGCTGG - Intergenic
1024703120 7:51926350-51926372 CCAGCTTTTGCCCTTTCAGTAGG + Intergenic
1025842646 7:65165228-65165250 GCAGTTTTTGCTCTTCAAGCAGG + Intergenic
1025880399 7:65530740-65530762 GCAGTTTTTGCTCTTCAAGCAGG - Intergenic
1025893038 7:65671864-65671886 GCAGTTTTTGCTCTTCAAGCAGG + Intergenic
1032368549 7:131323865-131323887 ACCCCTTTTGCTCTTCCAGGTGG - Intronic
1033347804 7:140539356-140539378 ACAGCCTTTGGCCTTCCAGCAGG - Intronic
1033375046 7:140751841-140751863 ACAACTTTTCTGTTTCCAGCAGG + Intronic
1036802391 8:11802432-11802454 ACAGCGTTCGCGCTCCCAGCCGG + Exonic
1045240592 8:100397303-100397325 ACAGCTATTGCTCTTACAGTAGG - Intronic
1047061516 8:121231922-121231944 ACATCTTTTGTACTTCTAGCAGG - Intergenic
1049241932 8:141542211-141542233 AAAACTTTTGCTCATCCAGCTGG - Intergenic
1055420682 9:76138000-76138022 AAGGCTTTTGCCATTCCAGCTGG + Intronic
1059624868 9:116052363-116052385 ACAGCTTTTAAACTTTCAGCAGG + Intergenic
1061486576 9:130923463-130923485 CCAGCTGTGGCTCTTCCAGCAGG - Intronic
1186397643 X:9225825-9225847 ACAGCTCTTGGGGTTCCAGGAGG + Intergenic
1190128135 X:47723870-47723892 AGATCTTTTGCGCCTCCTGCAGG + Intergenic