ID: 1006906487

View in Genome Browser
Species Human (GRCh38)
Location 6:37536747-37536769
Sequence GCGGCTGGTGGCGGAGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006906477_1006906487 7 Left 1006906477 6:37536717-37536739 CCACCGGCAGGCTCCAGGATTTA No data
Right 1006906487 6:37536747-37536769 GCGGCTGGTGGCGGAGATGGAGG No data
1006906481_1006906487 -6 Left 1006906481 6:37536730-37536752 CCAGGATTTAGCCTGTGGCGGCT No data
Right 1006906487 6:37536747-37536769 GCGGCTGGTGGCGGAGATGGAGG No data
1006906473_1006906487 17 Left 1006906473 6:37536707-37536729 CCGGCTAACCCCACCGGCAGGCT No data
Right 1006906487 6:37536747-37536769 GCGGCTGGTGGCGGAGATGGAGG No data
1006906475_1006906487 9 Left 1006906475 6:37536715-37536737 CCCCACCGGCAGGCTCCAGGATT No data
Right 1006906487 6:37536747-37536769 GCGGCTGGTGGCGGAGATGGAGG No data
1006906478_1006906487 4 Left 1006906478 6:37536720-37536742 CCGGCAGGCTCCAGGATTTAGCC No data
Right 1006906487 6:37536747-37536769 GCGGCTGGTGGCGGAGATGGAGG No data
1006906476_1006906487 8 Left 1006906476 6:37536716-37536738 CCCACCGGCAGGCTCCAGGATTT No data
Right 1006906487 6:37536747-37536769 GCGGCTGGTGGCGGAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006906487 Original CRISPR GCGGCTGGTGGCGGAGATGG AGG Intergenic
No off target data available for this crispr