ID: 1006911536

View in Genome Browser
Species Human (GRCh38)
Location 6:37566515-37566537
Sequence TGCTCTGATGGTGGCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006911536_1006911553 27 Left 1006911536 6:37566515-37566537 CCCGCGCGGCCACCATCAGAGCA No data
Right 1006911553 6:37566565-37566587 GGGCCTGGAAGCCCAGCCCTGGG No data
1006911536_1006911552 26 Left 1006911536 6:37566515-37566537 CCCGCGCGGCCACCATCAGAGCA No data
Right 1006911552 6:37566564-37566586 GGGGCCTGGAAGCCCAGCCCTGG No data
1006911536_1006911544 7 Left 1006911536 6:37566515-37566537 CCCGCGCGGCCACCATCAGAGCA No data
Right 1006911544 6:37566545-37566567 ACCGCCCCGGCTGCACCCAGGGG No data
1006911536_1006911540 -6 Left 1006911536 6:37566515-37566537 CCCGCGCGGCCACCATCAGAGCA No data
Right 1006911540 6:37566532-37566554 AGAGCAGCACGCCACCGCCCCGG No data
1006911536_1006911548 12 Left 1006911536 6:37566515-37566537 CCCGCGCGGCCACCATCAGAGCA No data
Right 1006911548 6:37566550-37566572 CCCGGCTGCACCCAGGGGCCTGG No data
1006911536_1006911543 6 Left 1006911536 6:37566515-37566537 CCCGCGCGGCCACCATCAGAGCA No data
Right 1006911543 6:37566544-37566566 CACCGCCCCGGCTGCACCCAGGG No data
1006911536_1006911542 5 Left 1006911536 6:37566515-37566537 CCCGCGCGGCCACCATCAGAGCA No data
Right 1006911542 6:37566543-37566565 CCACCGCCCCGGCTGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006911536 Original CRISPR TGCTCTGATGGTGGCCGCGC GGG (reversed) Intergenic