ID: 1006912025

View in Genome Browser
Species Human (GRCh38)
Location 6:37569788-37569810
Sequence GCTGATGGAGGGGCAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006912016_1006912025 0 Left 1006912016 6:37569765-37569787 CCCTGGAGCCCCAGTCTGCTGGC No data
Right 1006912025 6:37569788-37569810 GCTGATGGAGGGGCAGAGCCAGG No data
1006912014_1006912025 1 Left 1006912014 6:37569764-37569786 CCCCTGGAGCCCCAGTCTGCTGG No data
Right 1006912025 6:37569788-37569810 GCTGATGGAGGGGCAGAGCCAGG No data
1006912018_1006912025 -8 Left 1006912018 6:37569773-37569795 CCCCAGTCTGCTGGCGCTGATGG No data
Right 1006912025 6:37569788-37569810 GCTGATGGAGGGGCAGAGCCAGG No data
1006912021_1006912025 -10 Left 1006912021 6:37569775-37569797 CCAGTCTGCTGGCGCTGATGGAG No data
Right 1006912025 6:37569788-37569810 GCTGATGGAGGGGCAGAGCCAGG No data
1006912017_1006912025 -1 Left 1006912017 6:37569766-37569788 CCTGGAGCCCCAGTCTGCTGGCG No data
Right 1006912025 6:37569788-37569810 GCTGATGGAGGGGCAGAGCCAGG No data
1006912020_1006912025 -9 Left 1006912020 6:37569774-37569796 CCCAGTCTGCTGGCGCTGATGGA No data
Right 1006912025 6:37569788-37569810 GCTGATGGAGGGGCAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006912025 Original CRISPR GCTGATGGAGGGGCAGAGCC AGG Intergenic
No off target data available for this crispr