ID: 1006912161

View in Genome Browser
Species Human (GRCh38)
Location 6:37570484-37570506
Sequence AGAGCTGCGAGGTGAGTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006912161_1006912170 23 Left 1006912161 6:37570484-37570506 CCGTGCACTCACCTCGCAGCTCT No data
Right 1006912170 6:37570530-37570552 GCGTTTCCTCCCGTCTGCTGGGG No data
1006912161_1006912169 22 Left 1006912161 6:37570484-37570506 CCGTGCACTCACCTCGCAGCTCT No data
Right 1006912169 6:37570529-37570551 TGCGTTTCCTCCCGTCTGCTGGG No data
1006912161_1006912168 21 Left 1006912161 6:37570484-37570506 CCGTGCACTCACCTCGCAGCTCT No data
Right 1006912168 6:37570528-37570550 CTGCGTTTCCTCCCGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006912161 Original CRISPR AGAGCTGCGAGGTGAGTGCA CGG (reversed) Intergenic
No off target data available for this crispr