ID: 1006912165

View in Genome Browser
Species Human (GRCh38)
Location 6:37570515-37570537
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006912165_1006912170 -8 Left 1006912165 6:37570515-37570537 CCCTTCCTGACTGCTGCGTTTCC No data
Right 1006912170 6:37570530-37570552 GCGTTTCCTCCCGTCTGCTGGGG No data
1006912165_1006912175 3 Left 1006912165 6:37570515-37570537 CCCTTCCTGACTGCTGCGTTTCC No data
Right 1006912175 6:37570541-37570563 CGTCTGCTGGGGCCAGCTCCGGG No data
1006912165_1006912176 9 Left 1006912165 6:37570515-37570537 CCCTTCCTGACTGCTGCGTTTCC No data
Right 1006912176 6:37570547-37570569 CTGGGGCCAGCTCCGGGCCTTGG No data
1006912165_1006912174 2 Left 1006912165 6:37570515-37570537 CCCTTCCTGACTGCTGCGTTTCC No data
Right 1006912174 6:37570540-37570562 CCGTCTGCTGGGGCCAGCTCCGG No data
1006912165_1006912168 -10 Left 1006912165 6:37570515-37570537 CCCTTCCTGACTGCTGCGTTTCC No data
Right 1006912168 6:37570528-37570550 CTGCGTTTCCTCCCGTCTGCTGG No data
1006912165_1006912169 -9 Left 1006912165 6:37570515-37570537 CCCTTCCTGACTGCTGCGTTTCC No data
Right 1006912169 6:37570529-37570551 TGCGTTTCCTCCCGTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006912165 Original CRISPR GGAAACGCAGCAGTCAGGAA GGG (reversed) Intergenic
No off target data available for this crispr