ID: 1006912168

View in Genome Browser
Species Human (GRCh38)
Location 6:37570528-37570550
Sequence CTGCGTTTCCTCCCGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006912164_1006912168 10 Left 1006912164 6:37570495-37570517 CCTCGCAGCTCTCTTGGGAGCCC No data
Right 1006912168 6:37570528-37570550 CTGCGTTTCCTCCCGTCTGCTGG No data
1006912160_1006912168 22 Left 1006912160 6:37570483-37570505 CCCGTGCACTCACCTCGCAGCTC No data
Right 1006912168 6:37570528-37570550 CTGCGTTTCCTCCCGTCTGCTGG No data
1006912161_1006912168 21 Left 1006912161 6:37570484-37570506 CCGTGCACTCACCTCGCAGCTCT No data
Right 1006912168 6:37570528-37570550 CTGCGTTTCCTCCCGTCTGCTGG No data
1006912165_1006912168 -10 Left 1006912165 6:37570515-37570537 CCCTTCCTGACTGCTGCGTTTCC No data
Right 1006912168 6:37570528-37570550 CTGCGTTTCCTCCCGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006912168 Original CRISPR CTGCGTTTCCTCCCGTCTGC TGG Intergenic