ID: 1006912170

View in Genome Browser
Species Human (GRCh38)
Location 6:37570530-37570552
Sequence GCGTTTCCTCCCGTCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006912161_1006912170 23 Left 1006912161 6:37570484-37570506 CCGTGCACTCACCTCGCAGCTCT No data
Right 1006912170 6:37570530-37570552 GCGTTTCCTCCCGTCTGCTGGGG No data
1006912165_1006912170 -8 Left 1006912165 6:37570515-37570537 CCCTTCCTGACTGCTGCGTTTCC No data
Right 1006912170 6:37570530-37570552 GCGTTTCCTCCCGTCTGCTGGGG No data
1006912160_1006912170 24 Left 1006912160 6:37570483-37570505 CCCGTGCACTCACCTCGCAGCTC No data
Right 1006912170 6:37570530-37570552 GCGTTTCCTCCCGTCTGCTGGGG No data
1006912166_1006912170 -9 Left 1006912166 6:37570516-37570538 CCTTCCTGACTGCTGCGTTTCCT No data
Right 1006912170 6:37570530-37570552 GCGTTTCCTCCCGTCTGCTGGGG No data
1006912164_1006912170 12 Left 1006912164 6:37570495-37570517 CCTCGCAGCTCTCTTGGGAGCCC No data
Right 1006912170 6:37570530-37570552 GCGTTTCCTCCCGTCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006912170 Original CRISPR GCGTTTCCTCCCGTCTGCTG GGG Intergenic
No off target data available for this crispr