ID: 1006912175

View in Genome Browser
Species Human (GRCh38)
Location 6:37570541-37570563
Sequence CGTCTGCTGGGGCCAGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006912167_1006912175 -2 Left 1006912167 6:37570520-37570542 CCTGACTGCTGCGTTTCCTCCCG No data
Right 1006912175 6:37570541-37570563 CGTCTGCTGGGGCCAGCTCCGGG No data
1006912164_1006912175 23 Left 1006912164 6:37570495-37570517 CCTCGCAGCTCTCTTGGGAGCCC No data
Right 1006912175 6:37570541-37570563 CGTCTGCTGGGGCCAGCTCCGGG No data
1006912166_1006912175 2 Left 1006912166 6:37570516-37570538 CCTTCCTGACTGCTGCGTTTCCT No data
Right 1006912175 6:37570541-37570563 CGTCTGCTGGGGCCAGCTCCGGG No data
1006912165_1006912175 3 Left 1006912165 6:37570515-37570537 CCCTTCCTGACTGCTGCGTTTCC No data
Right 1006912175 6:37570541-37570563 CGTCTGCTGGGGCCAGCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006912175 Original CRISPR CGTCTGCTGGGGCCAGCTCC GGG Intergenic