ID: 1006912176

View in Genome Browser
Species Human (GRCh38)
Location 6:37570547-37570569
Sequence CTGGGGCCAGCTCCGGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006912167_1006912176 4 Left 1006912167 6:37570520-37570542 CCTGACTGCTGCGTTTCCTCCCG No data
Right 1006912176 6:37570547-37570569 CTGGGGCCAGCTCCGGGCCTTGG No data
1006912164_1006912176 29 Left 1006912164 6:37570495-37570517 CCTCGCAGCTCTCTTGGGAGCCC No data
Right 1006912176 6:37570547-37570569 CTGGGGCCAGCTCCGGGCCTTGG No data
1006912165_1006912176 9 Left 1006912165 6:37570515-37570537 CCCTTCCTGACTGCTGCGTTTCC No data
Right 1006912176 6:37570547-37570569 CTGGGGCCAGCTCCGGGCCTTGG No data
1006912166_1006912176 8 Left 1006912166 6:37570516-37570538 CCTTCCTGACTGCTGCGTTTCCT No data
Right 1006912176 6:37570547-37570569 CTGGGGCCAGCTCCGGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006912176 Original CRISPR CTGGGGCCAGCTCCGGGCCT TGG Intergenic