ID: 1006913294

View in Genome Browser
Species Human (GRCh38)
Location 6:37578258-37578280
Sequence TCAGCTCTGCAGACGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006913290_1006913294 -4 Left 1006913290 6:37578239-37578261 CCTGAAGGAGGTGAGGGAGTCAG 0: 2
1: 4
2: 58
3: 210
4: 722
Right 1006913294 6:37578258-37578280 TCAGCTCTGCAGACGCCTGGGGG No data
1006913285_1006913294 22 Left 1006913285 6:37578213-37578235 CCATAGGGGTGACAGTGGAGCAC No data
Right 1006913294 6:37578258-37578280 TCAGCTCTGCAGACGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006913294 Original CRISPR TCAGCTCTGCAGACGCCTGG GGG Intergenic
No off target data available for this crispr