ID: 1006913440

View in Genome Browser
Species Human (GRCh38)
Location 6:37579040-37579062
Sequence CATCCTACCTCCCTGGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006913433_1006913440 1 Left 1006913433 6:37579016-37579038 CCACAGGAGAAGCACCTCCGGCC No data
Right 1006913440 6:37579040-37579062 CATCCTACCTCCCTGGGGTGAGG No data
1006913430_1006913440 9 Left 1006913430 6:37579008-37579030 CCCTGTCACCACAGGAGAAGCAC No data
Right 1006913440 6:37579040-37579062 CATCCTACCTCCCTGGGGTGAGG No data
1006913431_1006913440 8 Left 1006913431 6:37579009-37579031 CCTGTCACCACAGGAGAAGCACC No data
Right 1006913440 6:37579040-37579062 CATCCTACCTCCCTGGGGTGAGG No data
1006913429_1006913440 16 Left 1006913429 6:37579001-37579023 CCACTGTCCCTGTCACCACAGGA No data
Right 1006913440 6:37579040-37579062 CATCCTACCTCCCTGGGGTGAGG No data
1006913427_1006913440 26 Left 1006913427 6:37578991-37579013 CCAGATTACTCCACTGTCCCTGT No data
Right 1006913440 6:37579040-37579062 CATCCTACCTCCCTGGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006913440 Original CRISPR CATCCTACCTCCCTGGGGTG AGG Intergenic
No off target data available for this crispr