ID: 1006915240

View in Genome Browser
Species Human (GRCh38)
Location 6:37589711-37589733
Sequence AATTAAGGTCATAGGTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006915240_1006915244 3 Left 1006915240 6:37589711-37589733 CCTGTGTACCTATGACCTTAATT No data
Right 1006915244 6:37589737-37589759 CAGATCCCCTCCTCACGTGGAGG No data
1006915240_1006915251 26 Left 1006915240 6:37589711-37589733 CCTGTGTACCTATGACCTTAATT No data
Right 1006915251 6:37589760-37589782 TGGGCTCCGCAAGCTCCATGTGG No data
1006915240_1006915243 0 Left 1006915240 6:37589711-37589733 CCTGTGTACCTATGACCTTAATT No data
Right 1006915243 6:37589734-37589756 CTGCAGATCCCCTCCTCACGTGG No data
1006915240_1006915246 7 Left 1006915240 6:37589711-37589733 CCTGTGTACCTATGACCTTAATT No data
Right 1006915246 6:37589741-37589763 TCCCCTCCTCACGTGGAGGTGGG No data
1006915240_1006915245 6 Left 1006915240 6:37589711-37589733 CCTGTGTACCTATGACCTTAATT No data
Right 1006915245 6:37589740-37589762 ATCCCCTCCTCACGTGGAGGTGG No data
1006915240_1006915252 27 Left 1006915240 6:37589711-37589733 CCTGTGTACCTATGACCTTAATT No data
Right 1006915252 6:37589761-37589783 GGGCTCCGCAAGCTCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006915240 Original CRISPR AATTAAGGTCATAGGTACAC AGG (reversed) Intergenic
No off target data available for this crispr