ID: 1006915242

View in Genome Browser
Species Human (GRCh38)
Location 6:37589726-37589748
Sequence GGAGGGGATCTGCAGAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006915242_1006915252 12 Left 1006915242 6:37589726-37589748 CCTTAATTCTGCAGATCCCCTCC No data
Right 1006915252 6:37589761-37589783 GGGCTCCGCAAGCTCCATGTGGG No data
1006915242_1006915251 11 Left 1006915242 6:37589726-37589748 CCTTAATTCTGCAGATCCCCTCC No data
Right 1006915251 6:37589760-37589782 TGGGCTCCGCAAGCTCCATGTGG No data
1006915242_1006915246 -8 Left 1006915242 6:37589726-37589748 CCTTAATTCTGCAGATCCCCTCC No data
Right 1006915246 6:37589741-37589763 TCCCCTCCTCACGTGGAGGTGGG No data
1006915242_1006915245 -9 Left 1006915242 6:37589726-37589748 CCTTAATTCTGCAGATCCCCTCC No data
Right 1006915245 6:37589740-37589762 ATCCCCTCCTCACGTGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006915242 Original CRISPR GGAGGGGATCTGCAGAATTA AGG (reversed) Intergenic
No off target data available for this crispr