ID: 1006915247

View in Genome Browser
Species Human (GRCh38)
Location 6:37589742-37589764
Sequence GCCCACCTCCACGTGAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006915247_1006915252 -4 Left 1006915247 6:37589742-37589764 CCCCTCCTCACGTGGAGGTGGGC No data
Right 1006915252 6:37589761-37589783 GGGCTCCGCAAGCTCCATGTGGG No data
1006915247_1006915251 -5 Left 1006915247 6:37589742-37589764 CCCCTCCTCACGTGGAGGTGGGC No data
Right 1006915251 6:37589760-37589782 TGGGCTCCGCAAGCTCCATGTGG No data
1006915247_1006915255 24 Left 1006915247 6:37589742-37589764 CCCCTCCTCACGTGGAGGTGGGC No data
Right 1006915255 6:37589789-37589811 CTGTCCAACACAATTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006915247 Original CRISPR GCCCACCTCCACGTGAGGAG GGG (reversed) Intergenic
No off target data available for this crispr