ID: 1006915252

View in Genome Browser
Species Human (GRCh38)
Location 6:37589761-37589783
Sequence GGGCTCCGCAAGCTCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006915250_1006915252 -9 Left 1006915250 6:37589747-37589769 CCTCACGTGGAGGTGGGCTCCGC No data
Right 1006915252 6:37589761-37589783 GGGCTCCGCAAGCTCCATGTGGG No data
1006915249_1006915252 -6 Left 1006915249 6:37589744-37589766 CCTCCTCACGTGGAGGTGGGCTC No data
Right 1006915252 6:37589761-37589783 GGGCTCCGCAAGCTCCATGTGGG No data
1006915247_1006915252 -4 Left 1006915247 6:37589742-37589764 CCCCTCCTCACGTGGAGGTGGGC No data
Right 1006915252 6:37589761-37589783 GGGCTCCGCAAGCTCCATGTGGG No data
1006915242_1006915252 12 Left 1006915242 6:37589726-37589748 CCTTAATTCTGCAGATCCCCTCC No data
Right 1006915252 6:37589761-37589783 GGGCTCCGCAAGCTCCATGTGGG No data
1006915241_1006915252 19 Left 1006915241 6:37589719-37589741 CCTATGACCTTAATTCTGCAGAT No data
Right 1006915252 6:37589761-37589783 GGGCTCCGCAAGCTCCATGTGGG No data
1006915240_1006915252 27 Left 1006915240 6:37589711-37589733 CCTGTGTACCTATGACCTTAATT No data
Right 1006915252 6:37589761-37589783 GGGCTCCGCAAGCTCCATGTGGG No data
1006915248_1006915252 -5 Left 1006915248 6:37589743-37589765 CCCTCCTCACGTGGAGGTGGGCT No data
Right 1006915252 6:37589761-37589783 GGGCTCCGCAAGCTCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006915252 Original CRISPR GGGCTCCGCAAGCTCCATGT GGG Intergenic
No off target data available for this crispr