ID: 1006915257

View in Genome Browser
Species Human (GRCh38)
Location 6:37589797-37589819
Sequence CACAATTCAGAGAGGCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006915253_1006915257 8 Left 1006915253 6:37589766-37589788 CCGCAAGCTCCATGTGGGTGTGT No data
Right 1006915257 6:37589797-37589819 CACAATTCAGAGAGGCCCAAAGG No data
1006915250_1006915257 27 Left 1006915250 6:37589747-37589769 CCTCACGTGGAGGTGGGCTCCGC No data
Right 1006915257 6:37589797-37589819 CACAATTCAGAGAGGCCCAAAGG No data
1006915249_1006915257 30 Left 1006915249 6:37589744-37589766 CCTCCTCACGTGGAGGTGGGCTC No data
Right 1006915257 6:37589797-37589819 CACAATTCAGAGAGGCCCAAAGG No data
1006915254_1006915257 -1 Left 1006915254 6:37589775-37589797 CCATGTGGGTGTGTCTGTCCAAC No data
Right 1006915257 6:37589797-37589819 CACAATTCAGAGAGGCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006915257 Original CRISPR CACAATTCAGAGAGGCCCAA AGG Intergenic
No off target data available for this crispr