ID: 1006922714

View in Genome Browser
Species Human (GRCh38)
Location 6:37637166-37637188
Sequence CAAGTGGAACAGCTGTCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006922714 Original CRISPR CAAGTGGAACAGCTGTCTCC AGG Exonic
901634272 1:10663402-10663424 CCAGGGGAACAGCTGTCTTTTGG - Intronic
901921203 1:12539143-12539165 CAAGTGGATCAGCAGCCTCTTGG - Intergenic
902454762 1:16524819-16524841 CAAGTGGAAGCGCTTTCTCTTGG + Intergenic
902458287 1:16552358-16552380 CAAATGTGACAGCTGACTCCAGG + Intergenic
902493874 1:16855558-16855580 CAAATGTGACAGCTGACTCCAGG - Intronic
902883445 1:19388051-19388073 GAAGGGAAACAGCTGGCTCCAGG - Intronic
903151473 1:21413118-21413140 CAAATGTGACAGCTGACTCCAGG + Intergenic
904163472 1:28537796-28537818 AAATGGGTACAGCTGTCTCCAGG - Intronic
904476498 1:30768459-30768481 CAAGTAAAACAGCTGACTTCCGG - Intergenic
905632655 1:39527273-39527295 CAAGGAGAACAGCGGTTTCCGGG - Intergenic
905678119 1:39844373-39844395 AAAGTAGAAAAGCAGTCTCCAGG + Intronic
907539107 1:55196140-55196162 CAAGTGAAAGAGGTGTTTCCAGG - Intronic
907852206 1:58266393-58266415 CTCGTGGAACTGCTGTTTCCTGG - Intronic
909711389 1:78653358-78653380 CAATTGGAAAAGCAGCCTCCTGG - Intronic
909715406 1:78701787-78701809 CGAGGGTAACAGCTGTCTCTGGG + Intergenic
910399539 1:86825089-86825111 CAAGTAGAACTGAGGTCTCCTGG - Intergenic
912419340 1:109532621-109532643 CAAGTGGAAGCTCAGTCTCCTGG - Intergenic
913454145 1:119013906-119013928 CAAGTAGAAAAGCTATCTTCAGG - Intergenic
913612080 1:120518476-120518498 CAAATGTGACAGCTGACTCCAGG + Intergenic
913962554 1:143351628-143351650 CAAGTGGAATGCCTGTCTCTGGG - Intergenic
914056909 1:144177213-144177235 CAAGTGGAATGCCTGTCTCTGGG - Intergenic
914122237 1:144789153-144789175 CAAGTGGAATGCCTGTCTCTGGG + Intergenic
914579109 1:149003762-149003784 CAAATGTGACAGCTGACTCCAGG - Intronic
915332895 1:155124704-155124726 CAACTGGAAATGCTGCCTCCAGG + Intergenic
918369750 1:183847569-183847591 GAAGGGGACCAGCTGCCTCCAGG + Exonic
918962191 1:191295145-191295167 CAAGTGTAACAGAGGTCTCTTGG + Intergenic
1068831208 10:61497346-61497368 CAAGTGGAACAGTTTTGCCCAGG + Intergenic
1070373955 10:75810984-75811006 CAAGTGGAGGAGCTGGGTCCAGG + Intronic
1070932559 10:80271669-80271691 CACGTGGAGCAGATGTCTCATGG - Intergenic
1071150802 10:82632025-82632047 CCAGTGCAACCTCTGTCTCCCGG - Intronic
1074268880 10:111933029-111933051 AAAGTGGAAGGGCTTTCTCCAGG + Intergenic
1075423412 10:122323349-122323371 CAAGTGGAACAGTCTTCTCAGGG + Intronic
1076469713 10:130710002-130710024 TAAGTGGATCAGCTGCCTCATGG + Intergenic
1076588158 10:131564174-131564196 GAAGTAGAACAGCAGTTTCCAGG + Intergenic
1076869926 10:133188236-133188258 CGTGTGGAACTGCTGTCACCTGG + Intronic
1077424646 11:2468932-2468954 GAAGTGGAACGGCTGTGTCATGG + Intronic
1081703112 11:45164296-45164318 CAACTGGAGCCTCTGTCTCCGGG - Intronic
1083005243 11:59338510-59338532 CTAGTGGAAGGGATGTCTCCTGG - Intergenic
1083026694 11:59557357-59557379 CAAGGAGAACAGCCGTCTCTGGG + Intergenic
1088765925 11:112977950-112977972 CAAGTGGAAAAGCTGAATACTGG + Intronic
1089390900 11:118100948-118100970 CAACTGGCAATGCTGTCTCCTGG + Intronic
1090309347 11:125721049-125721071 CAAGTGGAGCAGTTGCCACCAGG - Intergenic
1090815126 11:130286710-130286732 CTAGTGGACATGCTGTCTCCAGG - Intronic
1099573571 12:84356056-84356078 CAAGTAGCAGAGCTGTCTCCAGG - Intergenic
1100668053 12:96777203-96777225 GAAGTGCAATGGCTGTCTCCAGG - Intronic
1100727938 12:97429305-97429327 TAAGGAGAACAGCTGTTTCCTGG + Intergenic
1101721636 12:107355369-107355391 CACGTGGAACAGCTGGTGCCTGG + Intronic
1103588719 12:121975247-121975269 CAAGAGAAACCGCTGCCTCCAGG - Exonic
1106730780 13:32539401-32539423 CAAGTAGAACAGCGAGCTCCTGG + Intergenic
1108707771 13:53005730-53005752 ACAGAGGAACAGGTGTCTCCAGG + Intergenic
1109222896 13:59658661-59658683 CAGCTGGAGCACCTGTCTCCTGG - Intergenic
1109326258 13:60870704-60870726 CAGGTGGAACAGCTGCCACCAGG - Intergenic
1113437564 13:110305729-110305751 CCAGTGGAGAAGCTGCCTCCAGG + Intronic
1114793907 14:25690363-25690385 CAAGTGCCACAGCTGTATCAAGG + Intergenic
1119920727 14:78443559-78443581 CAAATGGAGCACCTCTCTCCAGG + Intronic
1121634166 14:95442578-95442600 CAAGTGGAAATGCAGACTCCAGG - Intronic
1122836041 14:104431620-104431642 CAAGTGGACCAGCCAGCTCCAGG + Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1126352487 15:47759053-47759075 GAAGTGGCACAGCTGACACCAGG - Intronic
1129032348 15:72628530-72628552 CAAGTGGAACACATGTCCCAAGG - Intergenic
1129407111 15:75327272-75327294 CAAGTGGAACACGTGTCCCAAGG - Intergenic
1133202406 16:4212341-4212363 CCAGTGGCACAGCTGCTTCCTGG - Intronic
1134573283 16:15309877-15309899 TAAGTGGAAATGCTGTTTCCAGG - Intergenic
1134729098 16:16446081-16446103 TAAGTGGAAATGCTGTTTCCAGG + Intergenic
1134938336 16:18265784-18265806 TAAGTGGAAATGCTGTTTCCAGG - Intergenic
1138193927 16:55038514-55038536 GAAGTGGCACAACTGTCCCCAGG - Intergenic
1138263525 16:55643273-55643295 CAGGTGGAACGGCTGTGTCTGGG - Intergenic
1138383141 16:56617477-56617499 CAAAAGGAGCAGCTGGCTCCAGG + Intergenic
1140047058 16:71447186-71447208 CAAGAGGATCACCTGACTCCAGG - Intergenic
1141116540 16:81314672-81314694 TAAGTGGAACAGCTGCAACCAGG + Intergenic
1141135832 16:81464733-81464755 CAAGTAGAACAGCAGTGACCAGG - Intronic
1141371144 16:83487358-83487380 AAAGTGGACCTGATGTCTCCAGG - Intronic
1142929267 17:3268645-3268667 CCAGTGGTGCAGCTGTCTCAAGG - Intergenic
1149008164 17:51827079-51827101 CAGGTGGAGTAGCTGTCTGCTGG - Intronic
1149421043 17:56511050-56511072 GGAGCGGAACAGCAGTCTCCAGG + Intronic
1152009743 17:77704927-77704949 CCTTTGGAACAGCTGTTTCCTGG + Intergenic
1153380806 18:4437255-4437277 CAAGTGGAACACCTGAATGCAGG + Intronic
1155273105 18:24159883-24159905 CAAGTGGACAAGATGTCCCCAGG + Exonic
1155924782 18:31643694-31643716 CATGTGATACACCTGTCTCCTGG + Intronic
1156222769 18:35070301-35070323 AAAGTGGAACAGCTTTGTTCAGG + Exonic
1156464071 18:37337481-37337503 CATCAGGAACAGCTGCCTCCTGG - Intronic
1156487125 18:37473383-37473405 GATGTGGCACAGCTGTCTGCTGG + Intronic
1157531923 18:48428642-48428664 CAAATTGAACAGGTGTCTGCAGG - Intergenic
1157733338 18:50023797-50023819 AAAGTGGAATGGCTGCCTCCCGG + Intronic
1159833217 18:73303923-73303945 TAAGAGGAACAACTGTCTGCTGG - Intergenic
1163756260 19:19108092-19108114 CAGGTGGAGCTGCTGTCCCCAGG - Intronic
1165533461 19:36422847-36422869 TATGTGAATCAGCTGTCTCCTGG + Intergenic
1167115517 19:47487205-47487227 CAGATGGAACAACTGTCACCGGG + Intergenic
1167117642 19:47497466-47497488 CACCTGGGACAGCTGGCTCCTGG + Intronic
1202696392 1_KI270712v1_random:129886-129908 CAAGTGGAATGCCTGTCTCTGGG - Intergenic
1202709831 1_KI270714v1_random:12436-12458 CAAATGTGACAGCTGACTCCAGG + Intergenic
930403200 2:50918017-50918039 CAGGTGGAAGAGTTGTATCCAGG + Intronic
930687213 2:54322839-54322861 CAACTGCAACCTCTGTCTCCCGG + Intergenic
931673210 2:64668275-64668297 CAAGTTGAACTGTAGTCTCCTGG + Intronic
932687779 2:73887798-73887820 CAAGTAGAAGAGCTGTTGCCAGG + Intergenic
935108561 2:100070134-100070156 CAAGTGAAAAAAGTGTCTCCTGG + Intronic
936410476 2:112253946-112253968 TAAGTGGAAGAGCTATGTCCAGG - Intronic
937495295 2:122412882-122412904 TCAGTGGAACACCTGTATCCAGG - Intergenic
940338525 2:152554881-152554903 CAAGTAGCACAGTTGTCTCAAGG - Intronic
940834448 2:158505500-158505522 CAACTGCAACAGCTGTCAGCAGG - Intronic
940856080 2:158729678-158729700 CAAGGGCAAAAGCTGTCCCCAGG - Intergenic
944821113 2:203432365-203432387 TAATTAGAACAGCTGTCTTCAGG - Exonic
1168924826 20:1570940-1570962 CAACTGGATGAGCTGGCTCCTGG - Exonic
1168928681 20:1603945-1603967 CAACTGGATGAGCTGGCTCCTGG - Intronic
1168969697 20:1922488-1922510 CAACTGGATGAGCTGGCTCCTGG + Exonic
1169001537 20:2171370-2171392 TAAGAGGAACAGCTGTATCAGGG - Intronic
1169344020 20:4815938-4815960 CAAATACCACAGCTGTCTCCCGG + Intronic
1175930803 20:62492928-62492950 CCAGTGGAGCATCTGGCTCCTGG + Intergenic
1176154768 20:63613350-63613372 CAAGTGGGACACCAGCCTCCAGG + Intronic
1176708006 21:10129254-10129276 ACAGTTGAACATCTGTCTCCAGG - Intergenic
1176726143 21:10434719-10434741 CATATGGAACAACAGTCTCCTGG - Intergenic
1178726339 21:35055256-35055278 CAAGTGGAACAGAAGTTACCAGG - Intronic
1180288227 22:10772399-10772421 CATATGGAACAACAGTCTCCTGG + Intergenic
1181968392 22:26672306-26672328 AAAGTGGGACATCTGTCTACAGG - Intergenic
1182250605 22:28997127-28997149 GATGTGGAACAGCTGTGACCAGG - Intronic
1182470157 22:30543498-30543520 CAACTGGATGAGCTGGCTCCTGG + Intronic
1182582883 22:31325687-31325709 GAAGTGGAAAAGGGGTCTCCTGG + Intergenic
1183410748 22:37653833-37653855 CCACTGGGGCAGCTGTCTCCGGG - Exonic
1184973870 22:48047175-48047197 CAGGTGGAACAACTGAGTCCAGG + Intergenic
954334782 3:49909856-49909878 AAACTGGAACAGAGGTCTCCGGG - Intronic
954806347 3:53223170-53223192 CAAGTTGAACAGCTGTGTGCTGG + Intergenic
954902990 3:54035729-54035751 CAAGAGGAACAGCTGGATCTGGG + Intergenic
954904423 3:54047909-54047931 CAAGTGGACAAGATGTCCCCAGG - Intergenic
955076835 3:55621754-55621776 CAATTGGCCTAGCTGTCTCCTGG - Intronic
957436450 3:80183004-80183026 CATGTGGACCAGGTGGCTCCAGG - Intergenic
959295528 3:104530525-104530547 CAGGTGGAACAGCTCTCGCTGGG + Intergenic
959819483 3:110715654-110715676 TATGTGAAACAACTGTCTCCAGG - Intergenic
961158034 3:124697445-124697467 CAAGTGGCATACCTTTCTCCAGG - Intronic
965622198 3:170653204-170653226 CAATTGGATCTGCAGTCTCCTGG + Intronic
968246377 3:197153555-197153577 GAGGTGGAACAGCAGTATCCAGG - Intronic
969033189 4:4229437-4229459 CAAGTGGAATGCCTGTCTCTGGG + Intergenic
970139591 4:12967439-12967461 ACAGTGGAACAGTTGTCACCAGG + Intergenic
970560177 4:17274775-17274797 CACTAGGAACAGCTGTGTCCTGG + Intergenic
972199416 4:36696027-36696049 CAAGTGGAAAATGTGTTTCCAGG - Intergenic
972855576 4:43102363-43102385 AAAGAGGATCAGCTGTCTCAGGG + Intergenic
978251587 4:106637442-106637464 CAAGGGGAAAATCTGCCTCCAGG - Intergenic
981849925 4:149218354-149218376 CAGGTGGAACAGCTCCCACCGGG + Intergenic
984042214 4:174749164-174749186 CTACTGGAACAGTTGGCTCCAGG - Intronic
984502371 4:180572408-180572430 CGAGAGGAACAGCTATCTCAGGG - Intergenic
988870435 5:35384296-35384318 CAGGTGGAACAGCTCCCACCGGG + Intergenic
989170087 5:38465234-38465256 CCAGTGAACCAGCTGTCTCTGGG - Intergenic
990141592 5:52710843-52710865 CAAGCAGAACACCTGTTTCCTGG + Intergenic
993084888 5:83351052-83351074 CAAGGGGGAAATCTGTCTCCAGG - Intronic
995895894 5:117009933-117009955 CAAGTGGAACACCTGTGGTCGGG - Intergenic
996968035 5:129329269-129329291 GAAATGGAACAGATGTCTCAGGG - Intergenic
998632710 5:143917844-143917866 CAAGTGGAATTATTGTCTCCAGG - Intergenic
1000839077 5:166193944-166193966 CAATAGGAACAGCTGCCTACTGG + Intergenic
1001691408 5:173635212-173635234 CAAGAGGAAGAGCAGCCTCCTGG - Intergenic
1001915798 5:175558891-175558913 CAAGTGGAACACTTGGGTCCAGG + Intergenic
1002092527 5:176813544-176813566 CAAGAGGACCAGCTCTCCCCTGG - Intronic
1002518422 5:179775941-179775963 CAAGTGGAATTGCTTCCTCCGGG - Exonic
1004142370 6:13030680-13030702 CATGTGAAACAGCTGTCTGTTGG + Intronic
1005700738 6:28398222-28398244 CACGGGGACCAGATGTCTCCTGG + Exonic
1005786312 6:29249088-29249110 CAAGTGTAGGAGCTGTCTCCAGG + Intergenic
1006922714 6:37637166-37637188 CAAGTGGAACAGCTGTCTCCAGG + Exonic
1007230469 6:40344478-40344500 CAGGGGCAGCAGCTGTCTCCTGG - Intergenic
1008920478 6:56839113-56839135 CCCCTGGAACAGCTGTCCCCTGG + Intronic
1014952964 6:127580428-127580450 CAAGTGGAACACCTTTTACCAGG + Exonic
1016551677 6:145287264-145287286 TAGGTGGAACGGCTGCCTCCAGG - Intergenic
1016878472 6:148887090-148887112 CAAGCAGAACAGATCTCTCCTGG + Intronic
1019011520 6:168847219-168847241 CAAGAGAAACAGCTGGCCCCCGG - Intergenic
1019011590 6:168847552-168847574 CAAGAGAAACAGCTGGCCCCCGG - Intergenic
1019038021 6:169078424-169078446 ACAGTGTAACAGCTCTCTCCAGG - Intergenic
1019075805 6:169387363-169387385 CCAAAGGAACAGCTGTCACCAGG + Intergenic
1020670859 7:11109298-11109320 CAAATAGAACAGCTGACTCCTGG + Intronic
1021594177 7:22296856-22296878 CAAGTGGAAAAACTGCTTCCAGG + Intronic
1025926993 7:65968256-65968278 GAACGGGAACAGCTGCCTCCTGG + Intronic
1027138395 7:75639878-75639900 GAAGTGGAACAGGTATCCCCAGG + Intronic
1029737271 7:102471862-102471884 CAAGTAGAGCAGGTGTTTCCAGG - Intronic
1031206170 7:118760476-118760498 AAAGTTGAACAGCTAACTCCAGG + Intergenic
1033494252 7:141877607-141877629 CAGGTGGAACAGCTGCCACGAGG - Intergenic
1034611777 7:152377172-152377194 CATATGGAACAACAGTCTCCTGG + Intronic
1034788893 7:153950118-153950140 CAGGTGGAACAGGTGCCTACTGG + Intronic
1036085025 8:5604225-5604247 CAAGAAGAAAAGATGTCTCCAGG + Intergenic
1037508783 8:19560778-19560800 GAAGTGGAATTGCTGGCTCCTGG - Intronic
1039077388 8:33704038-33704060 CAAGAAGAAAAGCTGTCTTCAGG + Intergenic
1041550796 8:59098685-59098707 CAAGCCAAACAGCTGTATCCAGG - Intronic
1043757594 8:84022532-84022554 AAAGTGGAACCGCTTTCTCTTGG + Intergenic
1043947779 8:86273999-86274021 CAAGTGGATGAGCTGCCTTCTGG + Intronic
1053644963 9:40114755-40114777 ACAGTTGAACATCTGTCTCCAGG - Intergenic
1053760757 9:41348773-41348795 ACAGTTGAACATCTGTCTCCAGG + Intergenic
1054325983 9:63712653-63712675 ACAGTTGAACATCTGTCTCCAGG - Intergenic
1054539612 9:66261214-66261236 ACAGTTGAACATCTGTCTCCAGG + Intergenic
1057024687 9:91725894-91725916 CAAGTGCATCAGCTCCCTCCTGG + Intronic
1058033619 9:100226583-100226605 CAAGTGGATCAGCTGAGTTCAGG + Intronic
1059254297 9:112914690-112914712 CAAGTGGCAGAGCTGGCTTCAGG - Intergenic
1060145527 9:121249229-121249251 CGAGTGGATCACCTGACTCCAGG + Intronic
1060202214 9:121657878-121657900 CAAGGGAAACAGTTGGCTCCTGG - Intronic
1061463121 9:130756277-130756299 CAAGAGGCAGAGCTCTCTCCAGG - Intronic
1061926634 9:133809093-133809115 CAAGAGGAACTGCTGCCTGCTGG - Exonic
1062527681 9:136984914-136984936 AAGGTGGAACCGCTGGCTCCTGG + Exonic
1202792769 9_KI270719v1_random:98223-98245 ACAGTTGAACATCTGTCTCCAGG - Intergenic
1185634600 X:1542442-1542464 GAAGTGAAACAGCTGTCCCAAGG + Intergenic
1193431140 X:81407353-81407375 GAAGTAGAAGAGCTGTCTCCAGG - Intergenic
1198211971 X:134524813-134524835 TCAGTGGAACCTCTGTCTCCTGG + Intergenic
1201754754 Y:17474723-17474745 CCAATGCAACATCTGTCTCCCGG + Intergenic
1201799433 Y:17938990-17939012 CCACTGCAACATCTGTCTCCTGG + Intergenic
1201802120 Y:17966966-17966988 CCACTGCAACATCTGTCTCCTGG - Intergenic
1201846798 Y:18431262-18431284 CCAATGCAACATCTGTCTCCCGG - Intergenic
1202362112 Y:24121649-24121671 CCACTGCAACATCTGTCTCCTGG - Intergenic
1202362961 Y:24131447-24131469 CCACTGCAACATCTGTCTCCTGG + Intergenic
1202507817 Y:25538668-25538690 CCACTGCAACATCTGTCTCCTGG - Intergenic
1202508667 Y:25548466-25548488 CCACTGCAACATCTGTCTCCTGG + Intergenic