ID: 1006923431

View in Genome Browser
Species Human (GRCh38)
Location 6:37640863-37640885
Sequence CCTCACCAGCCCCAAAGGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 286}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006923431_1006923440 2 Left 1006923431 6:37640863-37640885 CCGTTCCTTTGGGGCTGGTGAGG 0: 1
1: 0
2: 2
3: 24
4: 286
Right 1006923440 6:37640888-37640910 CCTGGAAGACACTGGGGCTTGGG 0: 1
1: 0
2: 1
3: 40
4: 302
1006923431_1006923438 1 Left 1006923431 6:37640863-37640885 CCGTTCCTTTGGGGCTGGTGAGG 0: 1
1: 0
2: 2
3: 24
4: 286
Right 1006923438 6:37640887-37640909 TCCTGGAAGACACTGGGGCTTGG 0: 1
1: 0
2: 1
3: 38
4: 309
1006923431_1006923437 -4 Left 1006923431 6:37640863-37640885 CCGTTCCTTTGGGGCTGGTGAGG 0: 1
1: 0
2: 2
3: 24
4: 286
Right 1006923437 6:37640882-37640904 GAGGATCCTGGAAGACACTGGGG 0: 1
1: 0
2: 3
3: 27
4: 328
1006923431_1006923441 18 Left 1006923431 6:37640863-37640885 CCGTTCCTTTGGGGCTGGTGAGG 0: 1
1: 0
2: 2
3: 24
4: 286
Right 1006923441 6:37640904-37640926 GCTTGGGCCCTGTGAAAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 207
1006923431_1006923442 19 Left 1006923431 6:37640863-37640885 CCGTTCCTTTGGGGCTGGTGAGG 0: 1
1: 0
2: 2
3: 24
4: 286
Right 1006923442 6:37640905-37640927 CTTGGGCCCTGTGAAAGCCAGGG 0: 1
1: 0
2: 5
3: 19
4: 237
1006923431_1006923435 -6 Left 1006923431 6:37640863-37640885 CCGTTCCTTTGGGGCTGGTGAGG 0: 1
1: 0
2: 2
3: 24
4: 286
Right 1006923435 6:37640880-37640902 GTGAGGATCCTGGAAGACACTGG No data
1006923431_1006923436 -5 Left 1006923431 6:37640863-37640885 CCGTTCCTTTGGGGCTGGTGAGG 0: 1
1: 0
2: 2
3: 24
4: 286
Right 1006923436 6:37640881-37640903 TGAGGATCCTGGAAGACACTGGG 0: 1
1: 0
2: 2
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006923431 Original CRISPR CCTCACCAGCCCCAAAGGAA CGG (reversed) Intronic
902092726 1:13916216-13916238 CCACACCAGCCGCATATGAAGGG + Intergenic
902542776 1:17166391-17166413 CCTTACCAGCCCCCAAGCCAGGG - Intergenic
902594136 1:17496444-17496466 CCTCTCTATTCCCAAAGGAAAGG + Intergenic
902694259 1:18129597-18129619 CCTCACCAGCCCCACAGTGCTGG - Intronic
902987799 1:20166026-20166048 CCTCACCACCACCCCAGGAATGG - Intronic
903266868 1:22163013-22163035 CCTCAGCATCCCCTCAGGAAGGG + Intergenic
904884518 1:33726267-33726289 CCTCCCCAGCCCCCAAGGAGGGG - Intronic
905186825 1:36203116-36203138 CCTCAGCCTCCCAAAAGGAATGG + Intergenic
905466145 1:38155174-38155196 CCTCACCAGCCCCACAGGTGGGG - Intergenic
906144155 1:43550177-43550199 CCTCTCCAGCCTCCAAGGGAGGG + Intronic
906993687 1:50766677-50766699 CCCCAACAACTCCAAAGGAAGGG + Intronic
907436857 1:54455423-54455445 CCTTTCCAGGCCCAAAGGTAGGG + Intergenic
907561532 1:55394473-55394495 CCTTACCAGCCAGAAAGGATTGG - Intergenic
907898653 1:58717532-58717554 CCTCATTAGCCCCAGAGCAAGGG + Intergenic
907926477 1:58959213-58959235 CCTCTCCTCCTCCAAAGGAACGG + Intergenic
907986269 1:59533923-59533945 CCTCTCCTCCTCCAAAGGAACGG + Intronic
909412633 1:75373327-75373349 CCTCAACAGGTCCTAAGGAAGGG + Intronic
912503953 1:110142942-110142964 CCAAAGCAGCCCCAGAGGAAAGG - Intergenic
912627630 1:111219308-111219330 CCTCACTAGCCCCATGGTAAGGG - Intronic
914318283 1:146534646-146534668 CCTCACTTACCCAAAAGGAAAGG - Intergenic
914496077 1:148198711-148198733 CCTCACTTACCCAAAAGGAAAGG + Intergenic
914717538 1:150265085-150265107 CCTCAAGAGCCTCAAAGGATAGG - Intergenic
915536504 1:156539347-156539369 GCTCTCCAGACACAAAGGAATGG - Intronic
915576936 1:156785624-156785646 TGTCACCATCCCCAAAGCAAAGG - Intronic
917833128 1:178914411-178914433 CCTGAACAGCTCCTAAGGAAGGG - Intronic
918223608 1:182458232-182458254 CCTCTACAGCCACAGAGGAAGGG - Intronic
921096891 1:211894627-211894649 CCTTAGCAACCCCAAAGGGAAGG + Intergenic
922202648 1:223419311-223419333 CCTCATCAGCCCAGAAGGAAAGG + Intergenic
922622181 1:226997826-226997848 CCTCACCAAATGCAAAGGAATGG - Intronic
922744663 1:228037323-228037345 CCCCTCCAGCCCCAAAGGGTGGG + Intronic
922857032 1:228784100-228784122 CCTCACCTGCCCCAACCCAATGG + Intergenic
923326765 1:232886906-232886928 CCCCACCAGCCACACAGGATAGG - Intergenic
923474610 1:234321040-234321062 CCCCCCCCACCCCAAAGGAATGG + Intronic
1062913033 10:1226458-1226480 CCTCTCCTCCTCCAAAGGAATGG - Intronic
1063544505 10:6967250-6967272 ACTCTGCAGCCCCAAAGAAAGGG - Intergenic
1064228252 10:13506304-13506326 CCTCTGCAGCCTCAAAGGAAGGG - Intronic
1064470323 10:15628960-15628982 CCTATCCAGCCACAAAAGAAAGG - Intronic
1064777487 10:18795435-18795457 CCTGAACAGCTCCAAAGGAATGG + Intergenic
1066166573 10:32794931-32794953 CCTGAACAGCTCCTAAGGAAGGG - Intronic
1067540174 10:47145126-47145148 CCACTCCAGCCCCAGAGGAGGGG - Intergenic
1072752657 10:97994317-97994339 CATCCCTAGCCCCAAAGGAGAGG - Intronic
1073321252 10:102617518-102617540 CATGACCAGCCCCCCAGGAAGGG - Intronic
1076147126 10:128131683-128131705 ACCCACCAGCCCCTGAGGAAAGG - Intergenic
1076791171 10:132777605-132777627 CGTCCTCAGCCCCAAAGGGACGG - Intronic
1077109804 11:857214-857236 CCTGCCCAGCCCCCATGGAACGG + Intronic
1077410953 11:2403671-2403693 CCTGACCAGCCCCACTGGGAAGG - Exonic
1078523880 11:12085980-12086002 ACTCCCCAGCCCCAAACAAAGGG - Intergenic
1078926845 11:15882935-15882957 CCTCAGCAGCCGCAACTGAAAGG + Intergenic
1079256927 11:18838512-18838534 CCACAGCAGCCCTACAGGAAAGG + Intergenic
1079477934 11:20850771-20850793 CTTCTCCAGCACCAAAGTAAAGG - Intronic
1079560540 11:21814019-21814041 CCCCAACACCCCTAAAGGAAGGG + Intergenic
1082596261 11:55085454-55085476 CCTCTCCTCCTCCAAAGGAATGG + Intergenic
1083268433 11:61558024-61558046 CCTGCCCAGCCCCACTGGAAGGG + Intronic
1083718814 11:64593877-64593899 ACTCCCCAGCCCCCAGGGAAAGG - Intronic
1083759463 11:64807773-64807795 CATCACCACCCACATAGGAAGGG - Intronic
1083883811 11:65560986-65561008 CCTCATCAGCCCCTGAAGAAGGG - Intergenic
1084174568 11:67416561-67416583 CCTCATCAGCCCCCAGGGGATGG + Intronic
1085779819 11:79397810-79397832 GCTCACAAGCCCCAGAAGAAAGG - Intronic
1087324297 11:96701907-96701929 TCTGACCAGCCCTTAAGGAATGG - Intergenic
1087327266 11:96738956-96738978 CCTGAACAGCTCCTAAGGAAGGG - Intergenic
1088237586 11:107742046-107742068 CCTGAACAGCTCCTAAGGAAGGG - Intergenic
1088852377 11:113715496-113715518 CCTAACCAGCCCTGAAGGAGTGG + Intergenic
1089235707 11:117023245-117023267 CCTCACCACCCCCAAAGCACAGG + Intronic
1091193968 11:133716509-133716531 CCTCACCCGCATCAAGGGAATGG + Intergenic
1091233089 11:134000978-134001000 CTCCACCAGCCCCGAAAGAATGG + Intergenic
1092272812 12:7037082-7037104 CCTCACCAGCCTCTAAGGGGAGG - Intronic
1092714862 12:11378245-11378267 CCTCTCCTCCTCCAAAGGAATGG + Intronic
1096464376 12:51840209-51840231 CCTCACCAGCCCCAGATCACAGG - Intergenic
1096470042 12:51869892-51869914 CCTCAGCAGCCCTAAATCAAGGG - Intergenic
1096499763 12:52057545-52057567 CCACACCAGGTCCAAGGGAATGG + Intronic
1097150817 12:56978690-56978712 CCTCACCATCCTGAAGGGAAGGG - Intergenic
1098362696 12:69670454-69670476 CCTTTCCAGACCCAAAGAAAAGG - Intronic
1098678472 12:73321117-73321139 CCTCAGCAGCTCCAGAGAAACGG + Intergenic
1100437104 12:94581785-94581807 CTCCACCAGCCCCAAACGACTGG + Exonic
1101353944 12:103959162-103959184 AAACACCAGCTCCAAAGGAATGG - Intronic
1102650565 12:114439486-114439508 CCTCACCAGCAGGAAAGAAAGGG - Intergenic
1102981503 12:117245202-117245224 CCTCAGCAACCCCAGGGGAAAGG - Intronic
1104572302 12:129935693-129935715 GCTCAGGAGCCCCAAACGAAAGG - Intergenic
1104981994 12:132577303-132577325 CCCCACCAGAGGCAAAGGAATGG + Intronic
1106099338 13:26681129-26681151 CGTCACCAGCTGCATAGGAAGGG - Exonic
1106392485 13:29348109-29348131 AATCTCCAGCCCCAGAGGAAGGG + Intronic
1107655831 13:42591395-42591417 CCTCACCCTCCCCAGAGGAGAGG - Intronic
1107840455 13:44451814-44451836 CCCCAACAGCCCCACAGGTAAGG - Intronic
1112203324 13:97300082-97300104 CCCAACCAGCCGTAAAGGAAAGG + Intronic
1112488631 13:99842287-99842309 CCTCTCTATCCCTAAAGGAAAGG - Intronic
1114425667 14:22620683-22620705 CCTCTCCTCCTCCAAAGGAATGG - Intergenic
1114819005 14:25993559-25993581 CCACAACAGCCTGAAAGGAAAGG + Intergenic
1115883350 14:37945263-37945285 CCACAACAGCTCCAAGGGAATGG + Intronic
1118894168 14:69931991-69932013 CCTCACCAGGGCCAAAGCCATGG + Intronic
1119542446 14:75449531-75449553 CCTCATCACCCCCAAAAGACTGG - Intronic
1120248989 14:82038998-82039020 CCTCCCAAGCCCCGAGGGAAGGG + Intergenic
1120348896 14:83327391-83327413 GTTCACTAGCCCCAAAGGCAGGG + Intergenic
1122616179 14:103019479-103019501 CCTCACCAGGCTCTAAGGCAGGG + Intronic
1122655902 14:103259150-103259172 AATCACCAGACCCAATGGAAGGG + Intergenic
1122692606 14:103538346-103538368 CCTCACCAGCCACAGAGGGTGGG + Intergenic
1124147081 15:27137815-27137837 ACCCACCACCACCAAAGGAAAGG - Intronic
1127605764 15:60586549-60586571 TCTGCACAGCCCCAAAGGAAAGG + Intronic
1128161827 15:65427927-65427949 CCTCAGCAGCCCCCAAGCAGTGG + Intergenic
1129151623 15:73692211-73692233 CCTCCCCAGCCCCCAGTGAATGG + Intronic
1129281661 15:74489915-74489937 CCTCACCCTCCCCAAATGACAGG - Intergenic
1129420951 15:75426260-75426282 CTGCCCCAGCCCCACAGGAAGGG + Intronic
1131268624 15:90933390-90933412 CCTCAGCTGCCCCTAAGGCAGGG - Intronic
1132542779 16:519072-519094 CCTCAGCTGCCCCACAGGCAGGG - Intronic
1132572634 16:650693-650715 CCTCACCAGGCTCAAAGCACAGG - Exonic
1132581801 16:688169-688191 CCTGGTCAGCCCCAAAGGACTGG + Intronic
1133874457 16:9720692-9720714 CCTCTCCCTCCCCGAAGGAAAGG + Intergenic
1134187425 16:12095712-12095734 ACTCCCCAGCCCCAAAAAAAGGG - Intronic
1135341098 16:21648679-21648701 CCTCCCCTGCCGCAAAAGAAGGG - Intronic
1135860441 16:26051197-26051219 ACTCCCCACCCCCACAGGAAGGG - Intronic
1135956039 16:26956920-26956942 CCATACCAGGCCCAAAGGCAGGG - Intergenic
1136871964 16:33815927-33815949 CCTCACCAGGCCTGAAAGAACGG - Intergenic
1138007882 16:53354791-53354813 GCCCCCCAGCCCCAAGGGAATGG + Intergenic
1138089387 16:54161760-54161782 GCTCGCCAGCACCACAGGAAGGG - Intergenic
1138909656 16:61380965-61380987 CCTCCTCAGCCCCAAAGTAGTGG + Intergenic
1139123055 16:64043484-64043506 GCTCACCACCCTCAAGGGAAGGG + Intergenic
1139289385 16:65843735-65843757 ACTTACCAGCCTCAAAGAAAAGG + Intergenic
1140234941 16:73150283-73150305 CCACACCAGCCCCAAACTACAGG - Intergenic
1141493452 16:84390447-84390469 CCTCCCTAGCCCCAAGGAAACGG - Intronic
1141950728 16:87337651-87337673 CCACACCTGCCCCTCAGGAAAGG + Intronic
1203100208 16_KI270728v1_random:1300141-1300163 CCTCACCAGGCCTGAAAGAACGG + Intergenic
1143268515 17:5658576-5658598 CCTCCCCAGCCCCAAACCCATGG - Intergenic
1143727305 17:8858095-8858117 GGTCAGCAGCCCCAAAGGACAGG - Intronic
1143884150 17:10053539-10053561 CACCACCAGCCCCATGGGAAGGG + Intronic
1144685025 17:17220498-17220520 CATCACGAGACCCAAAGGGAAGG + Intronic
1145776333 17:27531567-27531589 TCTCAGCAGCCCCACAGGAGGGG - Intronic
1146299743 17:31678675-31678697 ACTCAGCAGCCCCAATGGAGAGG - Intergenic
1146902931 17:36600074-36600096 CCCAACCAGCCCCAGAGGAGGGG + Intronic
1149537488 17:57443804-57443826 CCTCAAAAGCCCCTAAGGTAGGG - Intronic
1151086205 17:71384041-71384063 CCTCCCCATCCCCACAGGGAAGG - Intergenic
1152049624 17:77962067-77962089 CCTCTCCAACCCCAATTGAAGGG + Intergenic
1152290367 17:79436821-79436843 CCTCACCAGCCTCAGAGCCAGGG + Intronic
1152299102 17:79485086-79485108 TCCCACCAGCCCCAAAGCAGAGG + Intronic
1152521661 17:80860064-80860086 CCTCACCTGCCACACAGAAAAGG - Intronic
1156160819 18:34356123-34356145 CCTCACCAGTCCAAAATGACTGG + Intergenic
1156678246 18:39557439-39557461 ACTCATCATCACCAAAGGAATGG - Intergenic
1157828468 18:50834116-50834138 ACTCCCCAGCCCCCAAGGCAGGG + Intergenic
1159352001 18:67287011-67287033 CCTGAACAACCCCTAAGGAAGGG - Intergenic
1161900355 19:7114178-7114200 CATCACCAGCCTGAAAGGAGTGG + Intronic
1162700617 19:12512320-12512342 CCCCAGTATCCCCAAAGGAATGG + Intronic
1162728210 19:12702243-12702265 CCCCATGAGCCCCAAGGGAATGG + Intronic
1162968574 19:14167220-14167242 CCTGACCACCCCCAGAGGAAGGG - Intronic
1163829185 19:19539751-19539773 CCTCACCAGCCCTGGAGGACTGG + Exonic
1165751675 19:38264310-38264332 CGTCACCAAGCCCAAGGGAAGGG + Intronic
1165817405 19:38650433-38650455 CCTGCCCGGCCCCAGAGGAAGGG - Intronic
1166094907 19:40532329-40532351 CCCCACAAGCCCCCAAGGCAGGG - Intronic
1166408231 19:42539093-42539115 CCTCACCACCCTCAAGGGAAGGG - Intronic
1166773663 19:45299688-45299710 CCTCACCAGCCCGGAGGGACTGG + Intronic
1167100887 19:47403628-47403650 CCTCATCAGCCCCAATGTGAGGG + Intronic
1167150074 19:47703294-47703316 CCTCACAAACCCAAAAGCAATGG - Intergenic
1167740234 19:51320281-51320303 CATCAGCAGCCCCACAGGATGGG - Intronic
1168123727 19:54271261-54271283 CGTCATCAGCCCCAAAAGAAGGG + Intronic
1168128214 19:54298923-54298945 CATCAGCAGCCCCACAGGAAGGG + Intergenic
1168178628 19:54644260-54644282 CGTCATCAGCCCCACAAGAAGGG - Intronic
1168214981 19:54918728-54918750 CCTCAGCACCCCCAAAGTGATGG - Intergenic
924995718 2:358873-358895 ACTAACCAGCCCCAAATGAGAGG - Intergenic
925661463 2:6207663-6207685 CCTCACCAGACAGAAAGGCAGGG + Intergenic
925873156 2:8288060-8288082 CCTCACCACCCCCAAGGCAAGGG + Intergenic
926628694 2:15117724-15117746 TATCACCAGCTCCAAAGGATGGG - Intergenic
926801665 2:16665360-16665382 TCTCTACAGCCCCAAAGGGAGGG - Intronic
926893281 2:17657480-17657502 CCTCACCAGCCTATAGGGAAGGG - Intergenic
927193295 2:20531706-20531728 CCTCAACAGCCCCAGAGAAAGGG - Intergenic
927742209 2:25581738-25581760 CCTTTCCAGCTCCAAAGAAAAGG + Intronic
927866042 2:26588329-26588351 CCTTGCCACCCCCAAAGGAGGGG - Intronic
928170831 2:29002091-29002113 CATCACCAGCCGAAAAGGAAGGG + Intronic
929588597 2:43131225-43131247 CCTCCCCAGCCCCACAGGCTGGG - Intergenic
929708872 2:44245884-44245906 GAGCACCAGCTCCAAAGGAATGG - Intergenic
931491587 2:62754042-62754064 CCTCTCCCCCTCCAAAGGAACGG - Intronic
931549176 2:63424055-63424077 CCTGAACAGCTCCTAAGGAAGGG + Intronic
932435303 2:71699747-71699769 ATTCCTCAGCCCCAAAGGAAGGG + Intergenic
933847679 2:86338337-86338359 CCGGAGCAGCCCCCAAGGAAAGG - Intergenic
934551755 2:95267153-95267175 CCTCACCAGCCCACATAGAAAGG + Intergenic
935350037 2:102144770-102144792 ACTCAGCAGCCCCAATGGAGAGG + Intronic
938099789 2:128490905-128490927 ACTCACCAGCCTCAGGGGAAAGG + Intergenic
940235526 2:151507490-151507512 CCTCCCTAGACCCAGAGGAAAGG + Intronic
940444111 2:153755863-153755885 CCTCACCAGGCAAAAAGTAATGG + Intergenic
943754606 2:191544983-191545005 CCTCAGCAGGCCCAAAGGACTGG - Intergenic
944154349 2:196594222-196594244 ACTCAAAAGTCCCAAAGGAATGG - Intergenic
946090321 2:217216745-217216767 GCTCATCTGCCCCAAAGGGAGGG - Intergenic
948179079 2:235965973-235965995 TCTCTCCATCCCCAGAGGAACGG - Intronic
948949840 2:241242349-241242371 TCTGACCCGCCACAAAGGAAGGG + Intronic
1169208194 20:3751656-3751678 CCTCACCATCCTCAAAGGCGCGG + Exonic
1169263302 20:4153049-4153071 CCTCCCCAGCCCCTAAGGCCAGG - Intronic
1171198892 20:23225277-23225299 CCTATCCAACCACAAAGGAATGG + Intergenic
1171529526 20:25843687-25843709 CCTTACAAACCCCAAAGGAGTGG - Intronic
1171547300 20:26012193-26012215 CCTTACAAACCCCAAAGGAGTGG + Intergenic
1172577539 20:36020858-36020880 CCTCAGCAGCTTCAGAGGAAAGG + Intronic
1174332494 20:49831246-49831268 CCATACCAGCCTCAAAGGAAGGG - Intronic
1175286211 20:57838628-57838650 CCTCAGCAGTCCCACAAGAAAGG + Intergenic
1175648006 20:60692458-60692480 AAACACCAGCTCCAAAGGAATGG + Intergenic
1176411730 21:6452792-6452814 GCTTTCCAGCCCCAAAGGCAGGG + Intergenic
1177609987 21:23433888-23433910 ACTCATCAGTCCCAAAGAAATGG + Intergenic
1179687224 21:43061114-43061136 GCTTTCCAGCCCCAAAGGCAGGG + Intronic
1180692510 22:17728920-17728942 TCTTTCCAGCCCTAAAGGAAGGG + Intronic
1180692518 22:17728953-17728975 TCTTTCCAGCCCTAAAGGAAGGG + Intronic
1181009365 22:20031573-20031595 CCTCACCAGGCCCACAGGGATGG - Intronic
1182424277 22:30263950-30263972 CCCCACCAGGCCCTGAGGAAGGG - Exonic
1183675501 22:39296981-39297003 CCCCACCAGCCCCAAGGGAAGGG - Intergenic
1184519123 22:44982037-44982059 ACCCACCAGCCCCGAGGGAACGG + Intronic
951157704 3:19375655-19375677 CCTCTCCTCCTCCAAAGGAACGG - Intronic
951339409 3:21466605-21466627 CCTCACTAGCCTGAAAGAAATGG + Intronic
952270935 3:31830575-31830597 GCTGACCAGCCACAGAGGAAGGG - Intronic
952966376 3:38623548-38623570 CCTACCCAGCCCCAGAGGAGTGG + Intronic
953116281 3:39995130-39995152 CCTCTCCTCCTCCAAAGGAACGG + Intronic
953328630 3:42033778-42033800 CATCACCTGTCCCAAAGGAATGG - Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953774315 3:45802470-45802492 TCCCACAAGCCCCCAAGGAATGG + Intergenic
954443007 3:50531893-50531915 CGTAAGAAGCCCCAAAGGAAGGG + Intergenic
955824809 3:62934687-62934709 CCTGACCAATCCCAAAAGAAAGG - Intergenic
958483733 3:94676929-94676951 CCTCAGCAGCCCTACAGAAAAGG + Intergenic
960018958 3:112927348-112927370 CCTGAACAGCCCCAGAGAAAAGG + Intronic
961441432 3:126955566-126955588 CCACACCAGCGCCAAGGTAAAGG - Intronic
963032133 3:140988645-140988667 CCTCTCCCCCTCCAAAGGAATGG + Intergenic
966120939 3:176519324-176519346 CATCATCACGCCCAAAGGAAAGG - Intergenic
966780950 3:183583890-183583912 TCACACCAGCCCCACAGGGAAGG + Intergenic
967993088 3:195146176-195146198 CGTGACCAGCCCCACATGAAGGG - Intronic
968758689 4:2429913-2429935 CCTCACAAGTCCGAGAGGAATGG + Intronic
969098945 4:4754752-4754774 CCCCGCCGGCCCCAAAGGGAAGG + Intergenic
969629007 4:8324479-8324501 GCTCACCTGCCCAGAAGGAAGGG - Intergenic
969700343 4:8764452-8764474 CCTCACTAGCCCCCCGGGAAGGG - Intergenic
970121702 4:12760849-12760871 TCTCACCAGCCCGAGAGAAAAGG + Intergenic
971332606 4:25694655-25694677 CCTCAGCAGCCCCAAACCACAGG - Intergenic
972316016 4:37926538-37926560 CATCAGCACCCCCAGAGGAAGGG - Intronic
973015757 4:45135059-45135081 CCACTCCAGCCACAAAGAAAAGG - Intergenic
973651026 4:52997285-52997307 CCACTCAAGCCCCAAAAGAAAGG + Intronic
973842003 4:54871937-54871959 CCTCCCTAACCCAAAAGGAAAGG + Intergenic
977739782 4:100465226-100465248 CCACTGCAGCCACAAAGGAATGG - Intronic
978533637 4:109738559-109738581 CCTGCCCAGGCTCAAAGGAAAGG - Intergenic
985631420 5:1016010-1016032 ACCCAGCAGCCCCACAGGAAGGG - Intronic
985803729 5:2022907-2022929 CCTCAACAGTCCCACAGCAATGG - Intergenic
989415682 5:41172620-41172642 CATCACCATCCCCATGGGAAGGG - Intronic
990787066 5:59433501-59433523 TCTCTCCAGCCCCAGAGAAAGGG - Intronic
992195021 5:74330553-74330575 CACCAACAGCCCCAAGGGAAGGG + Intergenic
992995106 5:82324721-82324743 CCTCACCCGCCCCCAAGAAGGGG - Intronic
994028089 5:95108210-95108232 CCTTAGCTGCCCTAAAGGAAAGG + Intronic
995491484 5:112696893-112696915 CCTCCCCAACCCCAAATGACGGG + Intergenic
995712518 5:115049760-115049782 CATCAGCACCTCCAAAGGAAAGG + Intergenic
995758865 5:115543813-115543835 CCCCCCCACCCCCAAAGAAAAGG + Intronic
996188468 5:120509391-120509413 TCTCAGTAGCCCCAAAGGATTGG - Intronic
996260619 5:121462932-121462954 CCTCAGCATCCCCAAAGTACTGG + Intergenic
996379130 5:122845810-122845832 CCTCCCCCGGCCCAGAGGAAGGG + Intronic
997337584 5:133118961-133118983 GCTCAGCACCCCCAAAGGAGTGG - Intergenic
998007225 5:138665132-138665154 CCTCAGCTGCCCCCAAGGATGGG - Intronic
998385589 5:141755389-141755411 CTTCTCCAGCTCTAAAGGAATGG - Intergenic
998408086 5:141885861-141885883 CCTCCCCATACCCAGAGGAAAGG + Intergenic
999858219 5:155618098-155618120 CATCCCCTGCCCCAAAAGAAAGG - Intergenic
1000382501 5:160641683-160641705 ATTCAGCAGCCCCAAAGGAGAGG - Intronic
1000582920 5:163055929-163055951 CCTCACTATACCCAAAGGAAAGG + Intergenic
1001153168 5:169249832-169249854 TCTCACCACCCTCAAAGGGAAGG - Intronic
1001951563 5:175820212-175820234 CCCCACAAGGCCCAGAGGAAGGG - Intronic
1002433973 5:179220219-179220241 CCCCACGGGTCCCAAAGGAAGGG + Intronic
1004410457 6:15376894-15376916 CCTCACCAGCCCTAAAGTCTTGG - Intronic
1006108276 6:31729469-31729491 CCTCACAAGCCCCCAAGCAGGGG - Exonic
1006433047 6:34009950-34009972 TCTCACCAGGCCCATAGCAATGG + Intergenic
1006923431 6:37640863-37640885 CCTCACCAGCCCCAAAGGAACGG - Intronic
1009899630 6:69796335-69796357 ACTCACTAGCCCCAAGGGTAGGG + Intronic
1014745436 6:125194932-125194954 AAACACCAGCTCCAAAGGAATGG + Intronic
1016394264 6:143605525-143605547 CCTCCCCAGCATCAGAGGAAGGG - Intronic
1018404326 6:163462016-163462038 CCTCAACATCCCTAAAGTAAAGG - Intronic
1019445047 7:1066761-1066783 CCCCACATGCCCCAAAGGAGAGG + Intronic
1019735045 7:2646458-2646480 CCCCACCAGGCCCCAAGGAGAGG - Intronic
1019805234 7:3118701-3118723 CCTCAGCACCCCCAAAGTGATGG + Intergenic
1021143325 7:17054020-17054042 CCTCTCCTCCTCCAAAGGAATGG + Intergenic
1021895157 7:25226770-25226792 CCTAACCTGCCCCAAAGGTTTGG - Exonic
1023991822 7:45133150-45133172 GCTCACCAGCCCCAGAGGCAAGG + Intergenic
1025095394 7:56092129-56092151 CCTCCTCAGCCCCCCAGGAAAGG - Intronic
1025848168 7:65218720-65218742 CCTCAACACCCCCAAAGTACTGG + Intergenic
1026110142 7:67453111-67453133 CCCCACAAGCACCATAGGAAAGG - Intergenic
1028142124 7:87286016-87286038 CCTCAGCAAACCCAAAAGAATGG - Intergenic
1029450965 7:100641629-100641651 CCTCACCACCCCCAAGGGTGGGG + Exonic
1029515543 7:101020930-101020952 CCTCACCTGCCCCCAGAGAAGGG + Intronic
1031435148 7:121724385-121724407 CCTCTCCCCCTCCAAAGGAACGG - Intergenic
1032169889 7:129575935-129575957 CCTCAGGAGCCCAAAAAGAAGGG + Intergenic
1032193801 7:129778860-129778882 CCTCCCCACCCCCACAGGCAAGG - Intergenic
1032520251 7:132538359-132538381 CATCACCAGCTTCACAGGAAGGG + Intronic
1035758412 8:2051328-2051350 GCACACCAGCCCCAGAGGCAGGG - Intronic
1037300968 8:17451558-17451580 CATCACCAGCCTCAGAAGAAGGG - Intergenic
1037513371 8:19605731-19605753 CTTCCCCACCCCCAAAGAAATGG + Intronic
1038033199 8:23662631-23662653 CCTCACGGGCCCCCAAGGATTGG - Intergenic
1038936161 8:32254556-32254578 CCTCAGCAAACACAAAGGAATGG - Intronic
1039201455 8:35098124-35098146 CCTCACCAACCCACAAAGAAAGG - Intergenic
1039418324 8:37414687-37414709 GCTTACCAACCCCAGAGGAAAGG + Intergenic
1039448288 8:37649722-37649744 TGACACCTGCCCCAAAGGAATGG - Intergenic
1039491198 8:37948680-37948702 CCACACCAGGCCAAAAGGTATGG + Intergenic
1039790358 8:40871064-40871086 ATTCTCCATCCCCAAAGGAAAGG + Intronic
1047556097 8:125932020-125932042 CTTCACCAGCTCCAAAGTTATGG - Intergenic
1047801963 8:128319272-128319294 CCTCCCCAGCCCCCTAGGCAAGG - Intergenic
1049436189 8:142587313-142587335 GCTCAGCAGCCCCAAGGGCAGGG - Intergenic
1051478069 9:17530660-17530682 CCTCACCAGCCCCACAGGACTGG + Intergenic
1051839896 9:21383785-21383807 CATCCACAGCCACAAAGGAATGG - Intergenic
1052250801 9:26394636-26394658 CCTGAACAGCTCCTAAGGAAGGG - Intergenic
1055237983 9:74147570-74147592 CCTCAACAGGCCCATTGGAATGG - Intergenic
1055500881 9:76901248-76901270 CCTCATCAGCCCCTAAGCAAGGG + Intronic
1056558274 9:87707429-87707451 CCTCAGCATCTCCAAAGGGAAGG - Exonic
1057572686 9:96216420-96216442 CCACAGCACCCCCAGAGGAATGG + Intergenic
1060399640 9:123340713-123340735 CCCCTCCAGCCCCCAAGGAAAGG - Intergenic
1062436506 9:136548745-136548767 CCACAGCAGCCGCAAAGGAGGGG - Intergenic
1062466666 9:136684645-136684667 CCTCACCAGCCCCAAGCGCTGGG + Intronic
1186219684 X:7336244-7336266 CCCCACCCGCCCCAAAGGAGGGG + Intronic
1187601824 X:20839690-20839712 CCTCAGCAGTTCCTAAGGAAGGG - Intergenic
1187610506 X:20938616-20938638 CCTCACCACCCTGAAAGGAAGGG - Intergenic
1187850480 X:23586811-23586833 CCTTACCAGCCTCCAAGAAAAGG + Intergenic
1189299493 X:39942247-39942269 CATCACCAGCCTCAGAGGGAGGG + Intergenic
1190394188 X:49963174-49963196 CCTCTCCAGTCTCAAAGGAAGGG - Intronic
1191216081 X:57933534-57933556 CCTCACTAGCTCCGAAGAAAAGG - Intergenic
1191966810 X:66767692-66767714 CCTAACCAGAGCCAAAGAAAGGG - Intergenic
1195136280 X:101909846-101909868 CCTCGCCACCCTGAAAGGAAAGG + Intronic
1195167368 X:102233863-102233885 CCTCAGCAAACGCAAAGGAACGG - Intergenic
1195740142 X:108056766-108056788 CCTCACCACCACCAAATAAAAGG - Intronic
1195880418 X:109586876-109586898 TCTCACCAGCCCCACAGAACAGG + Intergenic
1197560227 X:128011678-128011700 CCTCACCATCCCCAGTTGAAGGG + Intergenic
1199601798 X:149545437-149545459 CCACAGCAGGCCCAAGGGAAGGG - Exonic
1199648581 X:149934046-149934068 CCACAGCAGGCCCAAGGGAAGGG + Exonic
1200408321 Y:2837455-2837477 CCTCACCCTCTCCAAAGGAGAGG - Intergenic