ID: 1006924386

View in Genome Browser
Species Human (GRCh38)
Location 6:37646454-37646476
Sequence CCCTGGGAGGTGGGCACGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 422}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006924386 Original CRISPR CCCTGGGAGGTGGGCACGGA AGG (reversed) Intronic
900139787 1:1134862-1134884 CCCTGGGGGCTGGGCAGCGATGG + Intergenic
900501726 1:3009148-3009170 CCACAGGAGGTGGGCATGGAAGG - Intergenic
900533105 1:3164434-3164456 CCCTGCCAGGAGGGCACCGAGGG + Intronic
900732643 1:4272317-4272339 ACCTGGGAGGTAGGACCGGAGGG + Intergenic
900935044 1:5759679-5759701 CCCTGCCAGGTGGGCATGCAGGG - Intergenic
900995672 1:6122024-6122046 CCCCGGGAGGTGGGCACAGCCGG + Intronic
901213782 1:7541817-7541839 CCCTGGGAGAGGTGCATGGAAGG + Intronic
901508423 1:9701209-9701231 CAGGGGGTGGTGGGCACGGAGGG - Intronic
901596276 1:10387745-10387767 CCCTGGGAGGTTTGCATAGAGGG + Intergenic
901805575 1:11736447-11736469 CCGTGGGAGGTGGCAGCGGAGGG + Intronic
902228812 1:15014336-15014358 CCCTGCAAGGTGGGCAGGGTGGG - Intronic
902583329 1:17423065-17423087 ACGTGGGAGGTGTGCACGGGTGG - Intronic
902593487 1:17491866-17491888 CACTGGGAGGTGGAGGCGGATGG - Intergenic
903021633 1:20399298-20399320 CCCTGGGAGGAGGCCAGAGAAGG + Intergenic
903168626 1:21538477-21538499 CCCTGGGTGGCGGGCGCAGAGGG - Intronic
904537400 1:31208935-31208957 CCCTGGGAGGTGAGAAGGGTAGG - Intronic
904768489 1:32868435-32868457 CACTGGGAGGTGGGCAGGAGCGG - Intronic
904920361 1:34003165-34003187 ACCTGGGACTTGGGCATGGATGG - Intronic
905024550 1:34840678-34840700 AGCTGGGACGTGGGCAGGGAGGG + Intronic
905137473 1:35810589-35810611 CTCTGGGAGGTAGGCAGGGCAGG + Intronic
905242307 1:36588948-36588970 CCCTGGGAGGTGGACTCAGCTGG + Intergenic
905281915 1:36854821-36854843 CCATGGGAGGTGGCCACGCAAGG + Intronic
905734185 1:40314911-40314933 CCCTTGGTGGTGGGCAGGCAGGG + Intronic
905949450 1:41936374-41936396 CCCTGAGAGGTGGAGATGGAGGG + Intronic
906072512 1:43027335-43027357 CCTTGGTATGTGAGCACGGAGGG - Intergenic
906199992 1:43953760-43953782 CCTTGGGAGTTGGGGATGGAGGG + Intronic
906608980 1:47189327-47189349 CCCTGGGAGGTGGGCAGGGTGGG + Intronic
907338870 1:53719339-53719361 CCATGCCAGGTGGGCAGGGAGGG - Intronic
908253221 1:62281721-62281743 CCCTGGGAGAAAGGCAGGGATGG - Intronic
910773991 1:90856622-90856644 CCCTGGGAGGTGGGGGTGGGGGG - Intergenic
911101736 1:94100960-94100982 TCCTGGGAAGTGGGCAGGGAGGG + Intronic
912612506 1:111062529-111062551 CCATGGCAGGTGGGGACGGGTGG - Intergenic
913294805 1:117309033-117309055 CCCTGGGAGGTAGGCAGGTCAGG - Intergenic
914363539 1:146957570-146957592 CCCTGGGACGGTGGCACAGATGG + Intronic
914488138 1:148129564-148129586 CCCTGGGACGGTGGCACAGATGG - Intronic
914802941 1:150974089-150974111 GCCTGCGAGGTGGGCACGGTGGG + Intronic
914900514 1:151708940-151708962 GCCTGGCAGGTGGGCAGGGTGGG + Intronic
915145478 1:153793884-153793906 CCCTGGGAGGAGGGGACAGTGGG + Intergenic
915605531 1:156947896-156947918 CTCTAGGAGGTGGGGAAGGAGGG + Exonic
915893901 1:159796180-159796202 CCCTGGGAGTTGGACACTCATGG - Intergenic
917890387 1:179431762-179431784 AGCTGGGAGGTGTGCACGGGTGG + Intronic
919805829 1:201380556-201380578 CACTGGGACCTGAGCACGGATGG + Intronic
920174367 1:204090897-204090919 CCCTGTGGGGTGGGAAGGGATGG + Intronic
920204777 1:204283500-204283522 CACTGGGAGGGAGGCAAGGAAGG + Intronic
920558645 1:206922925-206922947 CCATGTGAGGTGGGCAGGGTAGG - Intronic
921838987 1:219808378-219808400 TCCTGGGAGGTGGCCAGGGTGGG + Intronic
922423456 1:225474293-225474315 ACCTGTGAGGTGGAAACGGATGG - Intergenic
922545853 1:226456246-226456268 CCCTGGGAGATGGGGACAGAGGG - Intergenic
922572384 1:226641866-226641888 CCCCCTGAGGTGGGCACGGGTGG + Intronic
922724239 1:227915061-227915083 CACTGGGCAGTGGGCAGGGAGGG + Intergenic
922988300 1:229883906-229883928 CCCAGGGAGCTGGGCACAGTGGG + Intergenic
923107959 1:230868678-230868700 CCCGGGGAGGGGGCCACGGAGGG - Intronic
923132576 1:231090052-231090074 CTTTGGGAGGTGGAGACGGATGG + Intergenic
923280731 1:232440768-232440790 CCCTGGGAGGTGAGCCTCGAGGG - Intronic
923614332 1:235524427-235524449 TCCTGGGAGGCGGGGAGGGAGGG + Intergenic
924009329 1:239647526-239647548 CTTTGGGAGGTGGGCAAGGAAGG - Intronic
1062812908 10:478947-478969 CCCTGGGTGCTGGGGAAGGAGGG - Intronic
1063065050 10:2599811-2599833 ACCTGGGGGGTGGGCAAGGCAGG + Intergenic
1063981023 10:11451893-11451915 CCCAGGTAGGTGGGAACAGACGG - Intergenic
1064097851 10:12437008-12437030 TCCTGGGGGGTGGGCACACAGGG + Intronic
1064206522 10:13328824-13328846 GCCTGGGAGGTGGGGCTGGAAGG + Intronic
1064227566 10:13500858-13500880 GCATGGGAGGAGGGCACGGTGGG - Intronic
1064381344 10:14844223-14844245 CCCTGTGAGGTAGGCAGGGCAGG - Intronic
1065858312 10:29848776-29848798 CTTTGGGAGGTGGACACGGGTGG + Intergenic
1066449977 10:35520090-35520112 CACTGGGAGCTGGGCAGGGTGGG + Intronic
1067469068 10:46523265-46523287 CCCTGGGTGGGAGGCAGGGAGGG + Intergenic
1070111995 10:73495709-73495731 CCCTCGGGAGTGGGCCCGGAAGG - Intronic
1070151336 10:73807038-73807060 CCCAGGGAGGTGGACAGTGAAGG + Intronic
1070161197 10:73867664-73867686 CCCAGAGAGGTGGGTACAGACGG + Intronic
1070602837 10:77877776-77877798 CCCTGGAAGGTGGGGGTGGAGGG + Intronic
1070664950 10:78336291-78336313 CCCTGGGAGGTAGGCAGGGATGG + Intergenic
1070758517 10:79008627-79008649 TCCTGGGAGATGGGCATGTAGGG + Intergenic
1073396947 10:103225690-103225712 ACATGGGAGGTGGGAACTGATGG - Intergenic
1073981476 10:109158989-109159011 CCCTGGAAGGTGGGCTCAGCTGG + Intergenic
1075155801 10:119974955-119974977 CCCTGAGGGGTGGGCACTGAGGG - Intergenic
1075399478 10:122150640-122150662 CCCAGGGAGGTGGGGTAGGATGG + Intronic
1075704034 10:124488265-124488287 CCATGGGAGGTAGACACAGAAGG - Intronic
1075806379 10:125192116-125192138 GACTGGAAGGTGGGCATGGAGGG - Intergenic
1075903017 10:126058142-126058164 CCTTGGGAGGAGGGAAAGGAGGG - Intronic
1076067466 10:127460067-127460089 CCATGGGAGGTGTGCAGGGGAGG - Intergenic
1076546080 10:131246438-131246460 GGCTGGGAGGTGGGCAGGGCAGG + Intronic
1077264686 11:1642820-1642842 CCCTGGGAGGGAGGGAAGGAGGG - Intergenic
1077336269 11:2006094-2006116 TCCTGGAAGATGGGCACGGCTGG - Intergenic
1077340036 11:2022129-2022151 CACTGGGAGGAGGGCAGGGAGGG + Intergenic
1077439517 11:2561525-2561547 TCCTAGGAGGTGGGCACTGCTGG + Intronic
1078037941 11:7827381-7827403 CCCTAGGTGCTGGGCACTGAAGG - Intergenic
1078110267 11:8386553-8386575 GCCTGGGAGGTGGGCAGCCAGGG + Intergenic
1078432280 11:11297493-11297515 CCCAGGGAGGTGGGCAAGGGAGG - Intronic
1078715682 11:13836905-13836927 CCCTGGGAAGTGGACAGGGAGGG + Intergenic
1081659753 11:44880822-44880844 CCCTGGCAGGTGGGCTCTCACGG - Intronic
1081733642 11:45388807-45388829 TCCTGGGAGGTGGGCAAGGCAGG + Intergenic
1081846573 11:46244905-46244927 ACCTGGGAGATGGGCACACAGGG + Intergenic
1083642667 11:64153833-64153855 CTCTGGGAGGTGGGCTTGGCAGG - Intronic
1083718161 11:64590979-64591001 CTCTGGGAGGTGGGCACACAGGG + Exonic
1083781957 11:64923383-64923405 GCCTGGGAGGTGGGCAAGGAGGG + Intronic
1083827617 11:65212177-65212199 CCCTGGGAGGTTGGGAAGGAGGG + Intergenic
1084322028 11:68378421-68378443 CCCTGGGGTGTGGGTACCGACGG - Intronic
1084382945 11:68825345-68825367 TCCTGGGAGGTGGGCACCTGGGG - Intronic
1084420393 11:69057810-69057832 CCATGGGAGGTGGGCAGTGCTGG - Intronic
1084890334 11:72233587-72233609 CCTTGGGAGGTGGGAGCCGAGGG + Intronic
1085460026 11:76687992-76688014 CCCTGGGTGCTGAGCACCGATGG + Intergenic
1085511396 11:77090039-77090061 CCCTGTGAGATGGGCACTGTTGG - Intronic
1085696775 11:78711599-78711621 ACCTAGGAGGTAGACACGGATGG + Intronic
1087149130 11:94842838-94842860 CCCTGGGAGAGGGACAGGGAAGG - Intronic
1087377949 11:97367823-97367845 CCTTGGGTGGTGGGCAGGGTGGG + Intergenic
1088112506 11:106278146-106278168 CCCTGGGAGATGGGCACCTACGG + Intergenic
1088847168 11:113678293-113678315 TCCTGGGAGGTGGGCAGGCATGG - Intergenic
1089180455 11:116579926-116579948 TCCTCGGAGGTGTGCACTGAAGG - Intergenic
1089492115 11:118890324-118890346 CCTTGGGAGGGGGACACAGAAGG + Intronic
1089543880 11:119206979-119207001 GCCTGGGAGGTTAGCAGGGAGGG + Intronic
1090634586 11:128682843-128682865 CCCTGGGAGATGGTCACAGATGG - Intergenic
1202819253 11_KI270721v1_random:61276-61298 TCCTGGAAGATGGGCACGGCTGG - Intergenic
1202823021 11_KI270721v1_random:77318-77340 CACTGGGAGGAGGGCAGGGAGGG + Intergenic
1091705738 12:2691752-2691774 CCGTCGCAGGTGGGCAGGGACGG - Intronic
1091911956 12:4240116-4240138 TCCTGGGTGGTGGGCATGGAAGG + Intergenic
1092523652 12:9296407-9296429 ACCTTGGAGGTGGGCAGGAACGG - Intergenic
1092543645 12:9435492-9435514 ACCTTGGAGGTGGGCAGGAACGG + Intergenic
1096788645 12:54031852-54031874 ACCTGGGGGGTGGGCAGGGCAGG - Intronic
1098425887 12:70365907-70365929 CCCCGGGAAGCGGGCACGGGTGG - Intergenic
1098986144 12:77014618-77014640 CCCTGGGCGGTGAGTAAGGAAGG + Intergenic
1099435903 12:82644558-82644580 ACTTGAGAGGTGGGCATGGAAGG + Intergenic
1101740403 12:107495577-107495599 GACTTGGAGGTGGGCATGGAAGG - Intronic
1102679713 12:114683128-114683150 CCCGGTGAGGTAGGAACGGATGG + Exonic
1102960110 12:117086987-117087009 CCTTGGGAGGGAGGCAGGGAGGG + Intronic
1103138994 12:118532597-118532619 CCCAGGGAGGTGGTGATGGAGGG - Intergenic
1103511830 12:121480145-121480167 TCCAGGGAGGCGGGCAAGGAGGG + Intronic
1103559749 12:121787300-121787322 CCCTGGGAGGTGCGCTGGGTGGG + Intronic
1103603271 12:122067899-122067921 CCCTGGGAGGTGGGCAGGTCAGG - Intergenic
1103896509 12:124277145-124277167 ACCTGGGTGGTGGTCACGTAGGG + Intronic
1103937641 12:124484980-124485002 TCCAGGGAGGTGAGCACAGAGGG - Intronic
1104278461 12:127352223-127352245 CCCAGGGAGGTCAGCAGGGAAGG + Intergenic
1104568477 12:129904568-129904590 CCCTGGGAGATGCGCAGGGCGGG - Intergenic
1104775357 12:131387451-131387473 CCCTGGGATGTGGCCTCTGAGGG + Intergenic
1104842328 12:131830993-131831015 CCCTGGTTCCTGGGCACGGATGG + Intronic
1104970098 12:132527223-132527245 CTCTGGCGGGTGGGCACGGAGGG + Intronic
1104986443 12:132600249-132600271 CCCCGGCAGGTGGGCATGGCAGG + Intergenic
1105772922 13:23629948-23629970 CCCTGGTGGGTGAGCACTGAAGG + Intronic
1106236186 13:27862477-27862499 CCCTGGGTTGTGGGCCCAGAGGG + Intergenic
1106484040 13:30157023-30157045 TCCTGGGAGGCCGGCATGGAAGG - Intergenic
1110967146 13:81713690-81713712 CCCTGGGGGATGGGCACTTATGG + Intergenic
1111144051 13:84157462-84157484 TCCTGGGAGTTGGGCAGAGAGGG + Intergenic
1112288718 13:98126242-98126264 CCCTGGGAGATGTGCACGTGGGG - Intergenic
1112783772 13:102929642-102929664 CCCTGGGAGGTGGGGAGAGGAGG + Intergenic
1113200755 13:107866190-107866212 CCCGGGGAGGGGGGCAGGGTGGG + Exonic
1113444077 13:110352227-110352249 CCTTGGGAGGTAGGCATAGAAGG + Intronic
1113682785 13:112255898-112255920 CCCTGGGCGGTGGGTGGGGATGG - Intergenic
1113952726 13:114080710-114080732 CCCTGGGAGGTGGCCCCTGGGGG - Intronic
1117307782 14:54493304-54493326 CCCTGGGAAGTGCGCACACACGG + Intergenic
1119206429 14:72797883-72797905 CCCTGTGAGGTTGACAGGGAAGG - Intronic
1119480849 14:74956757-74956779 GCCTGGGAGCTGGACACAGAAGG - Intergenic
1119860164 14:77930440-77930462 TGCTGGGAGGCGGGCACAGAGGG + Intronic
1122179339 14:99944085-99944107 CTGTGGGAGGTGGACACGGGAGG + Intergenic
1122321612 14:100858973-100858995 CCCTTGGAGGTGGGCGGGGCTGG + Intergenic
1122429417 14:101630438-101630460 CCCAGGGATGGGGGCACGGCTGG - Intergenic
1122541105 14:102498039-102498061 GCCTGTGGGGTGGGCACAGATGG - Intronic
1122572998 14:102720777-102720799 CCCAAGGAGGAGGGGACGGAGGG - Intronic
1123041910 14:105493727-105493749 ATCTGGGAGGTGGGCTCTGATGG + Intronic
1123995013 15:25712347-25712369 CCCTGTGAGCTGTGCAAGGAAGG - Intronic
1124389135 15:29238183-29238205 CCCAGGGATGGGGGCAAGGAAGG + Intronic
1124720891 15:32110022-32110044 CCCTGGAAAGTGGGCATGGTAGG - Intronic
1125440070 15:39692219-39692241 TCCTGTGAGGTGGTCACTGAAGG - Intronic
1125874609 15:43133358-43133380 CCCTGCAAAGTGCGCACGGAAGG + Intronic
1126696455 15:51329956-51329978 CCCTGGGATGTGGGGCTGGAGGG + Intronic
1127932236 15:63604536-63604558 CCCCAGAAGGTGGGCACTGATGG + Intergenic
1127974605 15:63987895-63987917 CCCTGGGAAGTGGGCAGGGCAGG - Intronic
1128078609 15:64843102-64843124 AAGTGGGAGGTGGGCACTGAAGG - Intronic
1128720041 15:69941501-69941523 CGCCCGGAGGTGGCCACGGAGGG + Intergenic
1128778032 15:70338756-70338778 AGCTGGGTGGTGGGCACCGAGGG - Intergenic
1128841352 15:70853850-70853872 GCCCGGGAGGTGGGCCCCGAGGG - Intronic
1129358953 15:75012527-75012549 CCCGGGGAGGTAGGGACGGCTGG + Intronic
1129471890 15:75760634-75760656 CCCTGGGAGGAGGTCATGGTGGG - Intergenic
1129604333 15:77017499-77017521 TCCAGGGAGGTGGGCATGGAGGG - Intronic
1129672084 15:77613097-77613119 CCCTGTGAGGTAGGCAGGGCAGG + Exonic
1129772140 15:78209107-78209129 TCCTGGGAACTGGGCAGGGATGG - Intronic
1129893891 15:79089954-79089976 CCGTGGGAGGCGGGTACAGAGGG - Intronic
1130989868 15:88869896-88869918 CTCTGGGAGGTGGGTATGGGAGG - Intronic
1131060427 15:89400549-89400571 GCCTGGGCGGTGGGTATGGAGGG + Intergenic
1131667918 15:94590090-94590112 CCCTGGGAAGTGGGTAGGAAAGG + Intergenic
1132302367 15:100784008-100784030 CCCAGGGAGGTGTGGACGGAGGG + Intergenic
1132578002 16:672703-672725 CTCTGTGAGGTGGGCACAGATGG + Exonic
1132610912 16:815998-816020 CCCTGCGGGGAGGGCACAGATGG - Intergenic
1132632708 16:927579-927601 CCCTGGGAGCTGGGAAGGGGAGG + Intronic
1132887699 16:2189769-2189791 CCCTGGGAGGTGGGAATGCTGGG + Intronic
1133054980 16:3141425-3141447 GCCCGGGAGGTGGCCACAGATGG - Exonic
1134316148 16:13120650-13120672 CCCTGGAAGGTTGGCAAAGAAGG + Intronic
1138229346 16:55325998-55326020 TCCTGGGAGGAGGGTAGGGAAGG + Intronic
1139655269 16:68383610-68383632 CCCTAGGAAGTGGGCAGGGAAGG - Intronic
1139914748 16:70421104-70421126 CCCTGGGAGGTGGGCTGGGGAGG + Intronic
1140476635 16:75242399-75242421 CCCTGGTTTGTGGGCACAGAAGG - Intronic
1140922331 16:79550853-79550875 CCCAGGGAGATTGGCACAGATGG + Intergenic
1141827878 16:86493688-86493710 CCCTAGCTGGTGGGCACGGCTGG + Intergenic
1142482421 17:227215-227237 CCCAGAGAAGTGGGCACGGCTGG - Intronic
1142961329 17:3554089-3554111 CCCTGGGAACTGGGCAGGGCTGG - Intronic
1143352358 17:6298079-6298101 CCCTGGGAGGGAGGCTGGGAGGG - Intergenic
1144065238 17:11618774-11618796 CCCTGCAAGGTGGGCAGGGAAGG + Intronic
1144493067 17:15731374-15731396 CCCTTTGAGGTGAGCACAGAGGG + Intergenic
1144581271 17:16460871-16460893 CCTAGGGAGGTGGGAAGGGACGG - Intronic
1145252236 17:21302940-21302962 CCCTGGGAGGTGAGCCCGGGAGG + Intronic
1146462625 17:33058211-33058233 CCCTGGGAGGTAGGTAAGGCAGG + Intronic
1146656877 17:34639722-34639744 CTCTGAGAGGTGGGCAGTGAAGG - Intergenic
1147158319 17:38556603-38556625 CTATGGGAGCTGGGCAGGGAGGG + Intronic
1147255115 17:39176733-39176755 CCATGGGAGGAGGGCAAGGCAGG + Intronic
1147359410 17:39921732-39921754 CTTTGGGATGTGGGCAGGGAGGG - Intronic
1147385282 17:40077487-40077509 CCCTGGGAGGAAGGAAAGGATGG - Exonic
1147567877 17:41548692-41548714 CCCGGTGAGGTGGGCAGGGCAGG - Intergenic
1147994110 17:44351994-44352016 GCCTGGGGGGTGGGCAGGAAAGG - Exonic
1148901850 17:50884507-50884529 GCCTGGGAGGTGGGGAAGGCAGG + Intergenic
1150223311 17:63509254-63509276 ACCCAGGAGGTGGGCAGGGATGG - Intronic
1151619582 17:75237760-75237782 CCCAGGGAGGTGGCCCAGGAAGG - Exonic
1151759389 17:76091898-76091920 GCCTGGAGGGTGTGCACGGAAGG + Intronic
1151827701 17:76532424-76532446 CGCTGGAAGGAGGGCAGGGAAGG - Intronic
1152111414 17:78359515-78359537 CCCCGGGCGGTGTGGACGGAGGG + Intronic
1152234588 17:79132154-79132176 CCCTGGGAGCTGGGAACTGTTGG - Intronic
1152380409 17:79939431-79939453 CCCTGGAGGGTGGGCACTGCTGG - Exonic
1152386708 17:79979177-79979199 CCATAGGAGCTGGGCAGGGAAGG + Intronic
1153624563 18:7011929-7011951 CCCTGGGAGGTGGGTGGGGGTGG - Intronic
1157273628 18:46294833-46294855 CCCTTGGTGGTGGGGACTGAGGG + Intergenic
1157329527 18:46693207-46693229 CCCTGGGGGGTGGGCACGTGAGG - Intronic
1157610624 18:48952676-48952698 CCCTGGGAAGTGTGCGCTGAGGG + Intergenic
1160447119 18:78936625-78936647 GCCGGGGAGGTGGGCAGGGAGGG + Intergenic
1160447155 18:78936717-78936739 GCCAGGGAGGTGGGCAGGGCAGG + Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160691413 19:461972-461994 CGCTGGCAGGTGGGGAGGGAGGG + Intergenic
1160821773 19:1062330-1062352 CCCTGGGAGGTGAGAGCGGTGGG - Intronic
1160978908 19:1807501-1807523 CCGTGGGAGCTGGGCTTGGACGG - Intronic
1161201113 19:3015302-3015324 CTCTAGGAGGTGGTCAGGGAAGG + Intronic
1161722856 19:5913351-5913373 CCCTTGGAGGTGGGCCTGGGTGG + Intronic
1162478850 19:10916386-10916408 TCCTGGGAGTGGGGCAGGGAGGG - Exonic
1163406484 19:17126204-17126226 CCCTGGGAGCTGGGAGCAGAGGG - Intronic
1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG + Intronic
1164755407 19:30685510-30685532 CCCAGGGAGGTAGAGACGGAAGG + Intronic
1164761251 19:30730006-30730028 CCAAGGGAGGTGGGCAATGAGGG - Intergenic
1165704558 19:37966523-37966545 CAGAGGGAGGTGGGCACGGCAGG - Intronic
1165906833 19:39199388-39199410 GCCAGGGAGGTGGGCAGGGCAGG - Intronic
1165948413 19:39458879-39458901 CCTCTGGAGGTGGGCAAGGAAGG + Exonic
1166103233 19:40583524-40583546 CCCTGGGAGAGGGGAAGGGAGGG + Intronic
1166196284 19:41207743-41207765 CGGTGGGAAGTGGGCAAGGAGGG + Intergenic
1166365108 19:42274256-42274278 CCTGGGGAGGTGGGCACTGCTGG + Intronic
1166377048 19:42333584-42333606 GGCTGGGAGGTGAGCACAGAGGG - Exonic
1167000863 19:46745488-46745510 GACTGGACGGTGGGCACGGAAGG - Intronic
1167038519 19:47008482-47008504 TCCTGGGAGGTGGGCGGGGTCGG - Intergenic
1167270389 19:48502580-48502602 CCCTGGGAGGGAGGCAAAGAAGG + Exonic
1167455884 19:49596624-49596646 CCGTGGGAGGTGGGGGCGGAGGG - Exonic
1167752168 19:51387785-51387807 TCCTGGGTGGTGGGTAAGGAAGG + Intronic
1168294191 19:55370621-55370643 CGCTCGGAGGAGGGCACGGAAGG + Intergenic
925408520 2:3625299-3625321 TGCTGAGGGGTGGGCACGGATGG + Intronic
925912761 2:8583946-8583968 CCCTGCGAGGCGGGCCGGGAGGG - Intergenic
927508355 2:23628966-23628988 GGCGGGGAGGTGGGCACGGCAGG - Intronic
928136840 2:28694093-28694115 GCCTGGGTGGTGGGCAAGAAAGG + Intergenic
928436962 2:31260934-31260956 CCCTGGGAGGTGGGCAGCTTGGG + Intronic
929458953 2:42087050-42087072 CTCTGGATGGTGGGCACTGATGG + Intergenic
929830648 2:45343987-45344009 ACCTTGGAGGTGGGCCCAGAAGG - Intergenic
931088377 2:58859936-58859958 TCCTGGGAGATGTGCATGGAAGG + Intergenic
931272672 2:60716609-60716631 ACTTGGGAGGTGAGCACGCATGG - Intergenic
931894771 2:66716497-66716519 CTCAGGGAGGTGGGCAGGGATGG + Intergenic
934714077 2:96533272-96533294 CCCTGGGGGAGGGGAACGGAGGG - Intergenic
935842853 2:107132316-107132338 CACTGGGAGGTGGGCAGCGCGGG - Intergenic
936465903 2:112749973-112749995 CACAGGGAGGTGGGCTCTGAGGG - Intronic
936525887 2:113241515-113241537 CCCTGGGAGGTGAACAGGGTGGG - Intronic
936531641 2:113280100-113280122 CAGTGGGAGGGGGGCAAGGAAGG + Intergenic
937233660 2:120417580-120417602 CCCTGGGGGGTGAGTAGGGAGGG + Intergenic
937242837 2:120473690-120473712 CCCTGTGAGGTTGGCAGGGAGGG - Intergenic
937272635 2:120663094-120663116 CCTGGGGAGGTGGGCAATGATGG - Intergenic
938307995 2:130267673-130267695 TCCTGTGAGGTGGGCGTGGATGG + Intergenic
938422618 2:131156596-131156618 CCCTGTGAGGTGGGGGCAGAAGG + Intronic
938447334 2:131389163-131389185 TCCTGTGAGGTGGGCGTGGATGG - Intergenic
941905183 2:170713059-170713081 CCCAGGGAGGCGGGCAGGGCCGG - Exonic
944615392 2:201453763-201453785 CCCTGGAAGGTTGGCAGGGCAGG + Intronic
947524769 2:230871375-230871397 CCCTGGGAGATGCCAACGGAAGG + Intronic
947572914 2:231249803-231249825 CCCGTGGAGGTGTGCACGGGTGG - Intronic
947572926 2:231249840-231249862 CCCGTGGAGGTGTGCACGGGTGG - Intronic
947572938 2:231249877-231249899 CCCGTGGAGGTGTGCACGGGTGG - Intronic
947572950 2:231249914-231249936 CCCGTGGAGGTGTGCACGGGTGG - Intronic
947572962 2:231249951-231249973 CCCGTGGAGGTGTGCACGGGTGG - Intronic
947572974 2:231249988-231250010 CCCGTGGAGGTGTGCACGGGTGG - Intronic
948126442 2:235567736-235567758 CACTGGGGGGTGGGCAGGGTGGG + Intronic
948604433 2:239125996-239126018 GCCTGGGAGATGGGCACTGTGGG + Intronic
948771238 2:240252257-240252279 CGCTGAGACGTGGGCACAGAAGG + Intergenic
948861522 2:240754964-240754986 CCCTGGGAGGGGAGCAGGGCTGG - Intronic
1169267670 20:4176572-4176594 CCCTGGGAGCTAGGTAGGGATGG + Intronic
1170602220 20:17849549-17849571 GACTGGGAGGTGGGAAGGGAAGG + Intergenic
1171009190 20:21498836-21498858 CCCTGGGAGGGTGCCATGGAAGG - Intergenic
1171173846 20:23036670-23036692 CCTTGGGAGGTGGCCACGCAGGG - Exonic
1171291807 20:23986645-23986667 CCTAGGGAGGTGGGGAGGGAGGG + Exonic
1171427779 20:25059003-25059025 CCCTGGGGGGCGGGGACGGCGGG + Intergenic
1171767894 20:29300356-29300378 TCCTGGCAGGTGGGCTCGAAGGG - Intergenic
1174377980 20:50138966-50138988 GCCTTTGAGGTGGGCAGGGAGGG - Intronic
1174404787 20:50296100-50296122 CCAGGGGAGGTGGGCACGGGGGG + Intergenic
1175130952 20:56789077-56789099 CCCTGGGCTGTGGGAAGGGAGGG + Intergenic
1175376203 20:58525666-58525688 CTCTGGGAAGGGGGCAGGGAAGG + Intergenic
1175977161 20:62716813-62716835 CTCTGCAAGGGGGGCACGGAGGG + Intronic
1176103997 20:63377112-63377134 CCTTGGGGGGTGGGGACAGAGGG + Intronic
1176143869 20:63556949-63556971 GCCAGGGAGGTGGGTAAGGAAGG - Intergenic
1178582087 21:33846020-33846042 CCCTGGGAGGTAGACAAGGGGGG - Intronic
1178910340 21:36668836-36668858 GCCGAGGAGGTGGGCACGGTGGG - Intergenic
1179603968 21:42499961-42499983 AGCTGGGAGGTGGGCCTGGAAGG - Intronic
1179708496 21:43195894-43195916 CGGTGGGAGGTGGGGAAGGAAGG + Intergenic
1179828671 21:43982611-43982633 CCGTGGGAGGTGGGTCCGGCCGG + Exonic
1179886224 21:44315344-44315366 CCCTGGGTGGTGGGCAAGGCGGG - Intronic
1179945468 21:44671103-44671125 CCCTGGGAGGAGTGCATAGATGG - Intronic
1180000343 21:44992744-44992766 CCCTGGGGGGTGGGCAGAGCAGG + Intergenic
1180000356 21:44992785-44992807 CCCTGGGGGGTGGGCAGAGCAGG + Intergenic
1180096937 21:45560166-45560188 CCCTGAGAGGTGGGGACGCCAGG + Intergenic
1180211387 21:46297264-46297286 GCATGGGAGGTGGGAAGGGAAGG - Intronic
1180785037 22:18542433-18542455 CCCTGAGAGGTGGGCTTTGAGGG + Intergenic
1181007708 22:20021790-20021812 CTCTAGGAAGTGGGCACAGAGGG + Intronic
1181128620 22:20716466-20716488 CCCTGAGAGGTGGGCTTTGAGGG + Intronic
1181241940 22:21481787-21481809 CCCTGAGAGGTGGGCTTTGAGGG + Intergenic
1181461591 22:23089078-23089100 TCCTGGGAGGTGAGGAGGGAGGG + Intronic
1181463576 22:23099062-23099084 CCTTGGAAGCTGAGCACGGAAGG - Intronic
1182555505 22:31126533-31126555 CCATGGGTGGAGGGCCCGGAAGG - Intronic
1182837042 22:33350620-33350642 CCCTTGGGGGTGGGCACCGTAGG + Intronic
1183301520 22:37061308-37061330 GCCTGGGTGGAGGGCACGGGAGG - Intronic
1183306457 22:37085662-37085684 TCCTGGGAAGGGGGCAAGGAGGG + Intronic
1183373521 22:37449143-37449165 CCCTGGGAGGCTGGCTGGGATGG + Intergenic
1183498958 22:38166898-38166920 TCCGTGGAGGTGGGCAAGGAAGG - Intronic
1183553324 22:38506019-38506041 ATCTGGGAGCGGGGCACGGATGG + Exonic
1184383999 22:44163955-44163977 CCGGGAGAGGTGCGCACGGAGGG + Intronic
1184520464 22:44991029-44991051 CCCTGGAAGGTGGGCAGGGCGGG - Intronic
1184643165 22:45882865-45882887 CCTAGGGAGGAGGGCAGGGATGG + Intergenic
1184661346 22:45967026-45967048 CCCTGGGTGAGGGGCAGGGATGG + Intronic
1184817102 22:46880763-46880785 CCATGGCAGGTGGGGAAGGAGGG + Intronic
1184841452 22:47054720-47054742 GCCTGGGAGGTGGCCAGTGAGGG + Intronic
1184861443 22:47175265-47175287 CCCTGGGGTGGGGACACGGAAGG - Exonic
1185376310 22:50484104-50484126 CCCTTGGAGGTAGGAACTGAGGG - Exonic
950544181 3:13629103-13629125 CCCTGGGAGGTGTGTGTGGAGGG + Intronic
950878384 3:16299970-16299992 CCCTGTGAGGTGGGCAGTGCAGG + Intronic
950965815 3:17145047-17145069 GCCTGGGATGTGTGCACAGATGG + Intergenic
951725794 3:25757400-25757422 CCCTGTGAGGTAGGCAGGGTAGG - Intronic
952706210 3:36380458-36380480 GCCGGGGAGGTGGGCAGGGCGGG + Exonic
953914024 3:46906562-46906584 CCCTGGGAGGTGGCCAGAGGGGG + Intergenic
954672868 3:52299856-52299878 CCCAGGGAGGAGGGCAGGGTAGG + Intergenic
955475108 3:59328501-59328523 CCCTGGGAGGTAGACAAGGCAGG + Intergenic
956273540 3:67473532-67473554 GCCTGGGAGGTTGGTACAGAAGG - Intronic
959566121 3:107834644-107834666 TTCTGGGAGGTCGGTACGGAGGG + Intergenic
961943107 3:130657188-130657210 CCCTGGGAGCTGGGAACAGGTGG - Intronic
962713437 3:138106967-138106989 CCCTGTGAGGTAGGCAGGGCTGG - Intronic
962885874 3:139627372-139627394 CAATGTGAGGTGGGCAGGGAGGG + Intronic
967107348 3:186264617-186264639 CTCTGGGAGGTGGGCAGGGCAGG + Intronic
967756342 3:193174307-193174329 CCCTGGGAGCTGGTCAGAGATGG + Intergenic
968600173 4:1505012-1505034 CACTGGGGGGTGGGTACTGAAGG + Intergenic
968817824 4:2830869-2830891 CCCTGGGAGAAGGGCACCGTGGG - Intronic
968909853 4:3472165-3472187 CCCGGGGAGGTGGGCACGGCTGG + Intronic
968940180 4:3633601-3633623 CCCTGGATGGGGGGCTCGGATGG + Intergenic
974385558 4:61200161-61200183 CGCTTGGAGGTGGGAACGGGAGG - Intergenic
975100967 4:70512620-70512642 CCTTGGGAGGTGAGCATGTACGG + Intergenic
977917215 4:102607579-102607601 CACTGGGAGGTGGGGACAAAAGG + Intronic
981429730 4:144645669-144645691 CCGTAGGAGGTGGGAAGGGAGGG - Intergenic
981549361 4:145927806-145927828 GCCTGTGAGGTGGGCAGGGAAGG - Intronic
984767095 4:183408164-183408186 CCCTGACAGGAGGGCACAGAAGG - Intergenic
984767372 4:183409896-183409918 CCCAGGGAGGTAGGCAGGGAAGG - Intergenic
985822674 5:2170605-2170627 CCCTGGGAGGAAGGCCTGGAGGG - Intergenic
987061989 5:14251710-14251732 CCCTGGGAGGTGGGAACAATTGG + Intronic
988224673 5:28397889-28397911 ACGTGGGAGGTGGGCAAGTAGGG + Intergenic
993323138 5:86500441-86500463 ACCTGGGAGGTGGACAGTGATGG + Intergenic
995396745 5:111694985-111695007 TCCTGGGAGGTGGGGTTGGAGGG + Intronic
995512310 5:112921752-112921774 TCCTGCGCGGTGGGCGCGGACGG - Intronic
998382210 5:141733787-141733809 CCCTAGGAGGTGGGAATGGGGGG + Intergenic
999323159 5:150626995-150627017 CTCTGGGAGGTGGGCAGGGCAGG + Intronic
999654228 5:153796939-153796961 ACCTGTGAGGAGGGCAGGGATGG - Intronic
999769073 5:154761443-154761465 TTCTGGGAGGTGGGCAGGGTGGG + Intronic
1000210689 5:159104237-159104259 CCCTGGCAGGTGGCGAGGGAAGG - Intergenic
1001083536 5:168684146-168684168 CTCTGTGAGATGGGCAGGGAAGG - Intronic
1001967058 5:175917732-175917754 CCCTGGGATGTGGGCAGACATGG - Intergenic
1001984573 5:176061949-176061971 CCCTGGGATGGGGCCTCGGAGGG + Exonic
1002001059 5:176196490-176196512 TCCTGGGAGGTGGGGGCGGGGGG - Intergenic
1002080304 5:176733578-176733600 CCCTCAGAGCTGGGCAGGGATGG - Intergenic
1002181588 5:177433724-177433746 GCCTGGGGGGTGGGGACGGTCGG - Intronic
1002249877 5:177921480-177921502 CCCTGGGATGTGGGCAGACATGG + Intergenic
1002253276 5:177942482-177942504 TCCTGGGAGGTGGGGGCGGGGGG + Intergenic
1002263050 5:178007571-178007593 CCCTGGGATGGGGCCTCGGAGGG + Intronic
1002367606 5:178725396-178725418 CCCTGGGAGGTGGAGAAAGACGG - Exonic
1002575463 5:180171462-180171484 GCCTCGGAGGTGGGCTCTGAGGG - Intronic
1002587067 5:180255703-180255725 GCCTGGGAGGAGGGCGAGGAAGG + Intronic
1002587137 5:180256378-180256400 TCCTGGGATGTGGGCAGGGGTGG + Intronic
1004112418 6:12732071-12732093 TCCTGGGAGGTGGGGGAGGAGGG + Intronic
1004706129 6:18125403-18125425 CCCTGGGAGGAGGGCAAGGCTGG - Intergenic
1006695322 6:35926048-35926070 CCCTGGGAGGCTGGCATGTATGG - Intergenic
1006717892 6:36131559-36131581 TCCTGGAAAGTGGGCAGGGAAGG - Intronic
1006924386 6:37646454-37646476 CCCTGGGAGGTGGGCACGGAAGG - Intronic
1007010839 6:38416132-38416154 CACTGGGAGGTGGGTAGGGTAGG + Intronic
1007092806 6:39194559-39194581 CCCTGGGTGTTGGGCAGAGATGG - Intronic
1007231286 6:40349220-40349242 CCCTGGGAGGAGGAGAGGGAGGG - Intergenic
1007821769 6:44565627-44565649 CCCTAGGGGCTGGGCACAGACGG + Intergenic
1007838671 6:44697665-44697687 CCCTTGGAGGTGGGAACAGCAGG + Intergenic
1008661562 6:53673186-53673208 GCCTGGGAGATGGGCAGGGGTGG - Intergenic
1008711136 6:54228479-54228501 CCCAGGCAGCTGGGCAGGGAGGG - Intronic
1010933437 6:81831866-81831888 GCCTGGGAGGTTGACACTGAAGG - Intergenic
1011704709 6:89989450-89989472 CCCAGGGAGGTGGGAAGGGAGGG + Intronic
1012160216 6:95874862-95874884 CCATGGGAGATGGGCATGGTAGG + Intergenic
1013273225 6:108560967-108560989 TCCTGGGAGGCGGGCGCGGCAGG + Exonic
1016743920 6:147557994-147558016 CCCTGGGAGGTAGGCACAGAGGG + Intronic
1017506430 6:155072783-155072805 GCCCAGGAGGTGGGCACAGAGGG + Intronic
1018995852 6:168709952-168709974 CCCTGGGAGGTGGCCAGTCAGGG + Intergenic
1019418714 7:939015-939037 CCCAGGGAGCTGGGCCTGGAAGG + Intronic
1019797600 7:3063333-3063355 CACTCTGAGGTGGGCAGGGAAGG - Intergenic
1020002934 7:4765867-4765889 CCCTGGGAAGTGGGGAAGCAGGG + Exonic
1020122537 7:5513285-5513307 GAGTGGGACGTGGGCACGGAGGG + Intronic
1022442875 7:30448198-30448220 CCCTGGATGATCGGCACGGATGG - Intronic
1022497113 7:30860168-30860190 CCCTGGGAAGTGGGGAGGCAGGG + Intronic
1022532411 7:31075326-31075348 CCCTGTGAGGCGGGCACTGTCGG + Intronic
1023877164 7:44293091-44293113 CCCTGGGAGAGGGGCTCTGATGG - Intronic
1024026187 7:45411910-45411932 CCTTGGGAGCTGGGAAGGGAGGG + Intergenic
1024322613 7:48086029-48086051 CTCTGAGAGGTGGGGAGGGAAGG - Intergenic
1024346421 7:48319123-48319145 CCCTGTGAGGTGGAGACGGGAGG + Intronic
1026824463 7:73572830-73572852 CTGTGGCAGGTGGGCAAGGAGGG - Exonic
1026909462 7:74083891-74083913 CCCGGGGAGGCGGGGGCGGAGGG - Intronic
1027238272 7:76310935-76310957 CCTGGGGCGGTGGGCAGGGAGGG - Intergenic
1029545157 7:101206670-101206692 CACTGGGAAATGGGCAGGGAGGG + Intronic
1029712896 7:102309185-102309207 CACTGGGAGTTGGGCAGAGATGG + Intronic
1030219747 7:107085211-107085233 ACAAGGGAGGTGGGCATGGATGG + Intronic
1031990015 7:128191435-128191457 CCCTGTGTGGTGGGCAGGGCAGG + Intergenic
1032158132 7:129487256-129487278 CCCTGGGAGGTGGAGGCGGGCGG - Exonic
1033275609 7:139969624-139969646 CCCAGGGAGGAGGGCATGGTTGG + Intronic
1033423705 7:141224681-141224703 CCCTGGGAAGTGGACTCAGATGG + Intronic
1034242962 7:149624106-149624128 CCTGGGGAGCTGGGCACGTAAGG + Intergenic
1034577691 7:152015282-152015304 TCCCTGGAGGTGGGAACGGAGGG - Intronic
1034678603 7:152910820-152910842 CCCTGGGAGGTGGCCACCCCAGG - Intergenic
1034951129 7:155297781-155297803 CCCTGGGCGGTGCGCGCGGGCGG + Exonic
1035712503 8:1729380-1729402 GCCTGGGGGGTGGGCACGAGGGG + Intergenic
1035754936 8:2023884-2023906 CCGCGGGAGCTGGGCAGGGATGG + Intergenic
1037411932 8:18607092-18607114 TCCTGTGAGGTGGGCACTGAAGG + Intronic
1037751615 8:21686008-21686030 CGATGGGAGGTGGGCAGGCATGG - Intergenic
1037813585 8:22100540-22100562 CCCTGGGAGCTGGGTGGGGAAGG + Intronic
1038420508 8:27431211-27431233 CTCTGGGAGGTGGGCAGGACAGG + Intronic
1038423770 8:27451566-27451588 CCCTGGGCGGTGGGCAAGGATGG - Intronic
1038446713 8:27609681-27609703 CTCTGCGAAGTGGGCACGGCGGG - Intronic
1039833065 8:41233160-41233182 CCCTGGGAGGTGGAGTGGGACGG - Intergenic
1039957393 8:42217976-42217998 GACTGGGACATGGGCACGGAAGG - Intergenic
1040915089 8:52561089-52561111 ACCTGGGAGGGGGGTATGGATGG - Intronic
1041255998 8:55980058-55980080 CCCCGGGAGGTGGCCACACAGGG + Intronic
1042214511 8:66416658-66416680 CCCTGGGAGGGTGGAAAGGATGG + Intergenic
1042483800 8:69330611-69330633 CCCTGGGAGGTGAGTGTGGATGG - Intergenic
1043655725 8:82662901-82662923 GCCTGGGAAGTGAGCACAGAGGG + Intergenic
1043745416 8:83868950-83868972 CCCAGGGAGGTGGGCTCAGGGGG - Intergenic
1046933800 8:119867368-119867390 TCCTGGGAGGTGAGCAGGGTTGG + Intergenic
1047411422 8:124627650-124627672 CCCTGGGAGATGGCCAGGGGTGG + Intronic
1048201781 8:132380670-132380692 CCCTGGGAGGGAGGGAGGGAGGG - Intronic
1048296335 8:133217330-133217352 CCATGGGAGGTGTGAAGGGAGGG + Intronic
1049216266 8:141409770-141409792 TCCTGGGAGCTGGGCACGCTGGG - Intronic
1049251000 8:141588918-141588940 GGCGGGGAGGTGGGCACGGAGGG + Intergenic
1049329613 8:142043231-142043253 CCCTAGGAGCTGGACACAGAGGG + Intergenic
1049645990 8:143735829-143735851 TCCTGGGGGGTGGGTAGGGAAGG - Intergenic
1049748694 8:144273664-144273686 CCCGGGGAGGTGGGCCGGGGTGG - Intronic
1049748847 8:144274204-144274226 CCCTGGTAGCAGGGCAGGGAGGG - Intronic
1051499249 9:17759120-17759142 CACAGGGAGGTGAGCAAGGAAGG - Intronic
1052816570 9:33106664-33106686 CCCTGGGAGGGAGGCAGGGAGGG + Intronic
1056721843 9:89078736-89078758 GCCTGGGAGGTGGGCAAAGGTGG + Intronic
1057727517 9:97578701-97578723 CCCTGGGAGGTGAGCAGGGCAGG - Intronic
1059117911 9:111615987-111616009 CACAGGGAGGTGGGCACTGAGGG + Intergenic
1059159886 9:112024009-112024031 CTATGGGGGGTGGGCAGGGATGG - Intergenic
1060051846 9:120383583-120383605 GCCTTGGAGGTGAGCAGGGAAGG - Intergenic
1060816555 9:126638286-126638308 CCCTGACAGGTGTGCCCGGATGG + Intronic
1061008572 9:127942289-127942311 CCCTGGGCAGAGGGCACGGTCGG + Exonic
1061022795 9:128027085-128027107 CCCTGGGAGGAGGGAAGGGCAGG - Intergenic
1061579960 9:131530735-131530757 CCCTGGGGGGTATGCTCGGAAGG + Intronic
1061817349 9:133205210-133205232 CCCTGGGAGGTCTGCTGGGAGGG - Intergenic
1061865387 9:133489469-133489491 CCCTGGAAGGTGGGGAGGGGAGG - Intergenic
1062242373 9:135547347-135547369 TCCTTGGAGGTGGGCAGGGCTGG - Intronic
1062429658 9:136521350-136521372 CCCTGGGGAGTGGGCAGGGAGGG - Intronic
1062532300 9:137007290-137007312 CCCAGGGAGGTGGGCGGGCAGGG + Exonic
1062585045 9:137245399-137245421 TCCTGCCTGGTGGGCACGGAGGG + Exonic
1062657880 9:137613552-137613574 TCCTGGGAGGTGGGCTCTGCAGG + Intronic
1062669629 9:137700256-137700278 CCCGGGGAGGTGGGCACTACAGG - Intronic
1185472188 X:390638-390660 CCCAGGGAGGTGAGGAAGGAGGG + Intergenic
1185878131 X:3715720-3715742 CCCTGTGAGTTAGGCATGGAAGG + Intergenic
1186402103 X:9269507-9269529 CCATGGGCGGTGGGCATGGAGGG + Intergenic
1189025685 X:37391152-37391174 GCCTGGGAGGTGGGTTTGGATGG + Intronic
1189390018 X:40568773-40568795 ACCTGGGAGGTGGGCAGAGGTGG - Intergenic
1190916019 X:54811666-54811688 CCCTGGGGGATGGGCACAGTGGG + Intronic
1191933792 X:66404620-66404642 GCTTGGGGGGTGGGCACTGATGG + Intergenic
1192543157 X:71992121-71992143 TACTGGGAGGTGGGCAGAGAGGG + Intergenic
1193151567 X:78129860-78129882 CCCTGTGAGGTAGGCAGGGTAGG + Exonic
1193919158 X:87404889-87404911 CCTTGGGAGGTGAGCACGCTTGG - Intergenic
1199608765 X:149596384-149596406 CCCTGGGACCTGTGCACTGAAGG + Intergenic
1199630357 X:149772976-149772998 CCCTGGGACCTGTGCACTGAAGG - Intergenic
1200149392 X:153943863-153943885 CACTGGGAGATGGGCAGGAAGGG + Intronic
1200168088 X:154051063-154051085 CCCTTGGATGTGGGCAGTGAAGG + Intronic
1200210348 X:154344339-154344361 CCCTGGGAGGGGGGCATTGGAGG - Intergenic
1200220504 X:154387753-154387775 CCCTGGGAGGGGGGCATTGGAGG + Intergenic
1201344264 Y:12965594-12965616 CTCTGGGAGGTGCGCAGGGCAGG + Intergenic
1202081233 Y:21086143-21086165 CCCTGGGAAGAGAGCACAGATGG - Intergenic