ID: 1006926048

View in Genome Browser
Species Human (GRCh38)
Location 6:37655691-37655713
Sequence CATCCTGACCTGAGTGTAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 105}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006926032_1006926048 28 Left 1006926032 6:37655640-37655662 CCCCCTCCCCTGTTGGATGCAGG 0: 1
1: 1
2: 1
3: 21
4: 243
Right 1006926048 6:37655691-37655713 CATCCTGACCTGAGTGTAGAGGG 0: 1
1: 0
2: 1
3: 2
4: 105
1006926035_1006926048 26 Left 1006926035 6:37655642-37655664 CCCTCCCCTGTTGGATGCAGGAG 0: 1
1: 0
2: 2
3: 38
4: 231
Right 1006926048 6:37655691-37655713 CATCCTGACCTGAGTGTAGAGGG 0: 1
1: 0
2: 1
3: 2
4: 105
1006926034_1006926048 27 Left 1006926034 6:37655641-37655663 CCCCTCCCCTGTTGGATGCAGGA 0: 1
1: 0
2: 4
3: 29
4: 185
Right 1006926048 6:37655691-37655713 CATCCTGACCTGAGTGTAGAGGG 0: 1
1: 0
2: 1
3: 2
4: 105
1006926039_1006926048 20 Left 1006926039 6:37655648-37655670 CCTGTTGGATGCAGGAGAAGTGG 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1006926048 6:37655691-37655713 CATCCTGACCTGAGTGTAGAGGG 0: 1
1: 0
2: 1
3: 2
4: 105
1006926031_1006926048 29 Left 1006926031 6:37655639-37655661 CCCCCCTCCCCTGTTGGATGCAG 0: 1
1: 0
2: 0
3: 18
4: 258
Right 1006926048 6:37655691-37655713 CATCCTGACCTGAGTGTAGAGGG 0: 1
1: 0
2: 1
3: 2
4: 105
1006926038_1006926048 21 Left 1006926038 6:37655647-37655669 CCCTGTTGGATGCAGGAGAAGTG 0: 1
1: 0
2: 1
3: 17
4: 171
Right 1006926048 6:37655691-37655713 CATCCTGACCTGAGTGTAGAGGG 0: 1
1: 0
2: 1
3: 2
4: 105
1006926036_1006926048 25 Left 1006926036 6:37655643-37655665 CCTCCCCTGTTGGATGCAGGAGA 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1006926048 6:37655691-37655713 CATCCTGACCTGAGTGTAGAGGG 0: 1
1: 0
2: 1
3: 2
4: 105
1006926037_1006926048 22 Left 1006926037 6:37655646-37655668 CCCCTGTTGGATGCAGGAGAAGT 0: 1
1: 0
2: 0
3: 13
4: 187
Right 1006926048 6:37655691-37655713 CATCCTGACCTGAGTGTAGAGGG 0: 1
1: 0
2: 1
3: 2
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006926048 Original CRISPR CATCCTGACCTGAGTGTAGA GGG Exonic
900760981 1:4470166-4470188 CATTTTGAGCTGAGTGAAGATGG + Intergenic
900804364 1:4757518-4757540 CATCCTGGCATGAGTGTGGCTGG + Intronic
901826994 1:11868609-11868631 CATCCTCACCTAAATGTATAAGG - Intergenic
906279836 1:44545631-44545653 AGACCTGACCAGAGTGTAGAGGG + Intronic
908294277 1:62697843-62697865 CATCCTTACCTGGCTGTAGTAGG - Intergenic
908321311 1:62981672-62981694 CATCCTGAACTGGGTGGGGAGGG - Intergenic
923842322 1:237686503-237686525 CATTCTGAGCTGAGTTTTGAGGG + Intronic
1062974475 10:1673120-1673142 AATACTGACCTGAGAGTTGATGG + Intronic
1063126686 10:3142352-3142374 CAGCCTGTCCTGATTGGAGAAGG - Intronic
1066065324 10:31757442-31757464 CATCCTCACCTGCTTCTAGAAGG - Intergenic
1066413755 10:35199647-35199669 CAGTCTGACCTGGGTGTAGTTGG - Intronic
1067741698 10:48900341-48900363 GATCCTGAACTGAGAGCAGAGGG + Intronic
1068976956 10:63020609-63020631 AACACTGACCTGACTGTAGATGG + Intergenic
1072591239 10:96830832-96830854 AATACTGTCCTGAGTGTTGAAGG - Intergenic
1074848076 10:117416514-117416536 CTTCCTGACCTTAATGTAAATGG + Intergenic
1076338911 10:129729137-129729159 CTTCTTGACCTGAGTGGACAGGG + Intronic
1084319344 11:68364837-68364859 CATGCTGCCCCAAGTGTAGATGG - Intronic
1087409268 11:97770104-97770126 CATCCAGAGCAGAGTTTAGAGGG - Intergenic
1090220514 11:125018850-125018872 CTTCCTGAACTGAGTTTTGAAGG + Intronic
1095923569 12:47556030-47556052 CATCCTGACTTGAAAGTATATGG - Intergenic
1104510380 12:129372429-129372451 GATCCTGACCTGACAGGAGATGG - Intronic
1106301217 13:28467569-28467591 GATCCTGAACTGAGTTTAAAAGG - Exonic
1106572537 13:30940279-30940301 CAACCTGAGCTGAGAGTAGTGGG + Intronic
1109578026 13:64287779-64287801 CTTCCAGACCTGATTGGAGAGGG + Intergenic
1111540089 13:89658164-89658186 CAGCCTTAGCTGAGTCTAGAAGG + Intergenic
1113835339 13:113325313-113325335 CATCAGGACCTGAGTCTATACGG + Exonic
1123806266 15:23877187-23877209 CATCCTGGCCTGAGAACAGAAGG + Intergenic
1124242103 15:28037287-28037309 CCTCCTGACCTGGGTGTAGAGGG - Intronic
1125002939 15:34790375-34790397 CATCCTGACTGGAAGGTAGATGG + Exonic
1129121195 15:73397775-73397797 CAGCCGGCCCTGTGTGTAGAGGG + Intergenic
1130930808 15:88426197-88426219 CATCCTGATCTGACTGTTCAGGG - Intergenic
1136050337 16:27645727-27645749 CTTCCTGACCGGAATGTGGATGG - Intronic
1137025662 16:35471526-35471548 CATTCAAACCTGTGTGTAGAGGG + Intergenic
1138354571 16:56367076-56367098 CATCCCCATCTGAGTTTAGATGG + Intronic
1139921462 16:70463226-70463248 CATCCTGACCTGCCAGTACAAGG + Exonic
1141473962 16:84259446-84259468 CAACCTCACCTGAGGGAAGAGGG + Intergenic
1142977625 17:3655313-3655335 CATGATCACCTGAGGGTAGAAGG - Exonic
1144399907 17:14886309-14886331 CCTGCTGACCTGAGTGCATAGGG - Intergenic
1146722928 17:35136066-35136088 CATTCTGAGCTGGGTCTAGAAGG + Intronic
1148955793 17:51352611-51352633 GTTCTTGGCCTGAGTGTAGATGG + Intergenic
1152128303 17:78460633-78460655 CATTCTGACCTGAGCGTTGTGGG - Intronic
1155927556 18:31673206-31673228 CAATCTGCCCTGAGTGGAGATGG + Intronic
1158416036 18:57250506-57250528 TCTCCTGAGCTGAGTCTAGAAGG + Intergenic
1168162991 19:54524774-54524796 CATACTGTCCTGAGTGTACGTGG + Intergenic
929378657 2:41322248-41322270 CATCCTGAATTGATTGTGGAGGG + Intergenic
932479909 2:72032885-72032907 CCTCCTGACGTGGGTGTGGATGG + Intergenic
933061843 2:77747778-77747800 CACACTGACCTGAGAGTAGGAGG - Intergenic
933996483 2:87673718-87673740 CATCATGAAGTGAGTGTCGAGGG + Intergenic
936081519 2:109435632-109435654 CATCCTGCCATGAGGGCAGAGGG + Intronic
936297369 2:111277192-111277214 CATCATGAAGTGAGTGTCGAGGG - Intergenic
936681062 2:114771913-114771935 CATACTGGCCTGAGAGTAAAGGG - Intronic
939994650 2:148908490-148908512 CACCCTGACCTTAGCGTAGTAGG + Intronic
945311599 2:208319939-208319961 CATCATGCCCTGAGTGTGCACGG - Intronic
947320636 2:228914251-228914273 CTTCCTGACATGCCTGTAGAAGG + Intronic
948040238 2:234895879-234895901 CAGCCTGACCTGAGTCAACATGG + Intergenic
1171545394 20:25997027-25997049 CATCCTGACCTGTGTGACAATGG + Intergenic
1172881486 20:38202704-38202726 CAGCCTGACCTGGGGGTGGAGGG + Intergenic
1174459199 20:50670886-50670908 CCTCCTGGCCTGAGTGTGGGTGG + Intronic
1184515179 22:44957358-44957380 ATTCCTGAACTGACTGTAGAAGG + Intronic
950002192 3:9665658-9665680 CATGCTGAACTGAGTTTTGAAGG - Intronic
951934715 3:28009454-28009476 CATTCTGACCTGCTTGTAGGTGG - Intergenic
955568330 3:60274117-60274139 CAAGCTGAACTGAGAGTAGAAGG - Intronic
957773861 3:84729873-84729895 CTTCCTGTCTTGAATGTAGAGGG - Intergenic
957798505 3:85043636-85043658 CACCCAGACTTGAGTGTAGTAGG - Intronic
965758161 3:172046154-172046176 CATCCTCATCTGTATGTAGATGG - Intronic
965927140 3:173995548-173995570 CTTTCTGCCCTGAGTGAAGAGGG + Intronic
966736240 3:183189349-183189371 CAACATGACCTGACTGGAGAAGG - Intronic
969056095 4:4403801-4403823 AATGCTGACCAGAGTGCAGAAGG + Intronic
969129582 4:4981742-4981764 CATCCTGAGCTGGGTTTTGAGGG - Intergenic
969967396 4:11011385-11011407 CATTCTGATGTGTGTGTAGAGGG - Intergenic
972887547 4:43510542-43510564 CCTCCTGGCCTGAGTTGAGAGGG + Intergenic
974667846 4:64988435-64988457 CATCCTGAACTGAGTATTGTGGG + Intergenic
975736893 4:77389680-77389702 CATCCTGACCTGATGCTACAGGG - Intronic
976221422 4:82759511-82759533 GATCCTGAGCAGAGTGTTGAGGG - Intronic
984150295 4:176121934-176121956 CATGCTGACTTGGGTATAGATGG - Intronic
985519746 5:368171-368193 CATCCATACCTGTGGGTAGAGGG + Intronic
994318743 5:98364803-98364825 CATCTTGACCTGTGGATAGATGG - Intergenic
1000491625 5:161921621-161921643 CACCAGGATCTGAGTGTAGAAGG - Intergenic
1003477970 6:6502385-6502407 CATCCAGGCCTGAGTGTTGTTGG - Intergenic
1004136810 6:12975334-12975356 GATCCTGACCAGAGTGGAAAGGG + Intronic
1006926048 6:37655691-37655713 CATCCTGACCTGAGTGTAGAGGG + Exonic
1007390047 6:41545822-41545844 CTTCCTGAGCCGAGGGTAGAAGG - Intergenic
1013710038 6:112886622-112886644 CCTCCTGACCTCAGTCTAGAGGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017772927 6:157656977-157656999 CATGCATACCTGAGTGTAGGTGG + Intronic
1018322362 6:162625018-162625040 GAGCCTTACCTGAGTGAAGAAGG - Intronic
1021625395 7:22588243-22588265 CAGACTGGCCTGAGTGCAGAAGG + Intronic
1023863808 7:44229463-44229485 CATCCTGAGCTCAGTGAGGAGGG - Exonic
1024995779 7:55272306-55272328 CTTCCTGACCTGATTGTATTTGG + Intergenic
1026586809 7:71662071-71662093 CATCCTGACCTTGGTCTGGATGG + Intronic
1029884819 7:103857467-103857489 CAACCTCACCTGGGTGTAGAGGG + Intronic
1034944599 7:155253744-155253766 CTTCCTGACTGGAGTGTGGAAGG + Intergenic
1035016430 7:155770348-155770370 CACAATGACCTGTGTGTAGAGGG + Intronic
1036464147 8:8980553-8980575 CAAGCTGACCTCAGTGCAGAAGG + Intergenic
1042462101 8:69081381-69081403 TAGCCTGAACTGAGTGTGGAAGG + Intergenic
1042816754 8:72886555-72886577 CTTTCTGAGCAGAGTGTAGATGG - Intronic
1043403990 8:79912071-79912093 CATCCTTGCCTTAGGGTAGAGGG - Intergenic
1045339483 8:101240209-101240231 CATCCTGACATGACAGCAGATGG - Intergenic
1047298042 8:123588609-123588631 CGTCCTGCCCTGTATGTAGATGG + Intergenic
1047939577 8:129816194-129816216 CTCCCTGGCCTGAGTGTAGCAGG + Intergenic
1050989278 9:12127371-12127393 CATCCTGACTTGAATTTCGAGGG + Intergenic
1052020204 9:23517076-23517098 CATGCTGAGCCCAGTGTAGATGG + Intergenic
1053434050 9:38063524-38063546 ACTCTTGAGCTGAGTGTAGAAGG - Intronic
1056375188 9:86001858-86001880 CATACTAACCTGAATGTAAACGG - Intronic
1057386001 9:94606583-94606605 CATCGTGGGCTCAGTGTAGACGG + Intronic
1185850132 X:3477444-3477466 CCTCCTGACCTCACTGTGGATGG - Intergenic
1186651306 X:11563677-11563699 CATCATAACCTAAGTCTAGAAGG + Intronic
1190735654 X:53254521-53254543 GATCCTGACCTGTTTGGAGAAGG + Exonic
1200759872 Y:7027990-7028012 CATCCTTACCTGTGTGCAGCAGG + Intronic