ID: 1006928034

View in Genome Browser
Species Human (GRCh38)
Location 6:37669599-37669621
Sequence CAGGGTCAGAAACATGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 4, 3: 20, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006928034 Original CRISPR CAGGGTCAGAAACATGGTTC TGG (reversed) Intronic
901565218 1:10108383-10108405 CAGAGGCTGAAACATAGTTCCGG + Intronic
902901431 1:19519010-19519032 CAGATTCAGAAACATCGCTCTGG + Intergenic
904318248 1:29679995-29680017 CAGGGTCTGAAACAGGGTGAAGG - Intergenic
905300767 1:36985022-36985044 CAGGAACAGAAAGATGATTCTGG + Intronic
907189407 1:52635692-52635714 CAAGGTTAGAATTATGGTTCAGG - Intronic
908400140 1:63765032-63765054 CTGGGTCAGAAAACTGGTCCTGG + Intergenic
910213509 1:84817985-84818007 CAAAGTCAGGAACATGGCTCTGG + Intronic
912192310 1:107354077-107354099 CAGGGTCATTGACATGGTTTGGG - Intronic
912763332 1:112387545-112387567 CAGGGATAGAAACCTGGTCCTGG + Intergenic
915910551 1:159912488-159912510 CAGGGTGAGAACCAGGGATCAGG - Intergenic
916122827 1:161544272-161544294 CAGGGCCAGAACCCAGGTTCTGG + Intronic
916132729 1:161625716-161625738 CAGGGCCAGAACCCAGGTTCTGG + Intronic
916260615 1:162838641-162838663 CAAGGTTAGAATTATGGTTCAGG + Intronic
917709445 1:177669814-177669836 CAGGGGCTGAAACATTGTTTGGG - Intergenic
918739155 1:188104812-188104834 CAGGGTCAGGAGCATAGCTCTGG + Intergenic
920438201 1:205961720-205961742 CAGGGTCAGGACCTTGGATCTGG - Intergenic
921093653 1:211867798-211867820 CAGGCTAAGAACCATGGTACAGG - Intergenic
922868799 1:228883589-228883611 CAGGGTTAGCACCATGGTGCTGG - Intergenic
923526314 1:234775508-234775530 CAGGGCCAGAAACATGGTTTGGG + Intergenic
923955405 1:239012739-239012761 CAGAGGCAGAACCATGGTTGAGG + Intergenic
1063457444 10:6194139-6194161 GAGGGTCAGAAACCAGGTTGGGG + Intronic
1063632046 10:7743231-7743253 CTGGGTCAGAAACCAGGTTGAGG - Exonic
1065222969 10:23514737-23514759 GAGGGTCAGAAAGGTGGTCCTGG + Intergenic
1066256739 10:33686827-33686849 CAGGGATAGAATAATGGTTCCGG + Intergenic
1067190501 10:44064057-44064079 CAGAGGCAGAAACCTGGTTAGGG + Intergenic
1068793330 10:61050602-61050624 CTGGGTTTGAATCATGGTTCTGG + Intergenic
1069689543 10:70340827-70340849 CAGGGTCTGAAGCCTGGTCCTGG - Intronic
1069870252 10:71528722-71528744 CAGGGTGGGGAACAGGGTTCTGG - Intronic
1071932313 10:90486069-90486091 CAGGGTGAGTAACATGGCTCTGG + Intergenic
1072584688 10:96770999-96771021 CAAGGTTAGAATTATGGTTCAGG - Intergenic
1073551220 10:104403477-104403499 CAGAGTCAGAGTCATGGTTCTGG - Intronic
1073566262 10:104538102-104538124 CAGGGTCAGGCACAGGGCTCTGG + Intergenic
1074424978 10:113342751-113342773 CAGGGCCAGGAACAGGGCTCAGG - Intergenic
1074894220 10:117761004-117761026 CAGGCACAGAAACAGAGTTCTGG + Intergenic
1075571810 10:123551734-123551756 CAAGGACAGAAACAGAGTTCAGG + Intergenic
1075863280 10:125696182-125696204 ATGGGTCAGAAACATGGGTCAGG - Intergenic
1076745801 10:132512869-132512891 CAGGGTCTGAAAGATGGACCAGG - Intergenic
1077486721 11:2842096-2842118 CAGGGACAGAGACAAGGTTGAGG + Intronic
1080069702 11:28066753-28066775 AAAGGTCAGAATCATTGTTCTGG + Intronic
1083259031 11:61513287-61513309 CAGGGCAAGAAACAGGGTTGGGG + Intergenic
1083619116 11:64040334-64040356 CAGGGACAGAAACAAGGGCCTGG + Intronic
1084145998 11:67265787-67265809 TAGGGTCAGAATCAAGGTTGGGG + Intergenic
1084199352 11:67545033-67545055 CAAGGTCAGGAACATGGCCCTGG + Intergenic
1084231599 11:67757517-67757539 CTGGGTCAGAAACCTTGGTCTGG + Intergenic
1084805431 11:71575690-71575712 CAGGATCAGAGACAGGGTTTGGG - Intergenic
1088906243 11:114157506-114157528 CAGGCTCAGAAACAAGGATGAGG - Intronic
1088941120 11:114457333-114457355 CAGGATAAGAAACATGATTTTGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1096048426 12:48585141-48585163 CAAGGTTAGAATTATGGTTCAGG + Intergenic
1100089720 12:90954728-90954750 GAGGGTCTGAGTCATGGTTCAGG + Exonic
1101639389 12:106576580-106576602 CAGGTTCAGATTCAAGGTTCTGG - Intronic
1101939725 12:109090883-109090905 CAAGGAGAGAAACATGGTCCTGG + Intronic
1103588779 12:121975796-121975818 ATGGATCAGAAAGATGGTTCTGG + Intronic
1104409698 12:128547793-128547815 CAGGTCCAGAAAGGTGGTTCTGG + Intronic
1104627532 12:130370827-130370849 AAGGCTCAGTCACATGGTTCGGG + Intronic
1107120134 13:36787260-36787282 CACAGGCAGAAACATGGTTAGGG - Intergenic
1107210581 13:37849380-37849402 CATGGTCAAAAACAAGCTTCAGG - Intronic
1109524096 13:63553208-63553230 CAGTGTCACGATCATGGTTCAGG + Intergenic
1112343676 13:98573168-98573190 CAGGATCAAAAACAAGTTTCAGG - Intronic
1115882870 14:37939767-37939789 CAGGGTGAGAAAACAGGTTCAGG + Intronic
1116199824 14:41777902-41777924 CAGAGTCAGAAACAGGATTAAGG - Intronic
1120149848 14:81021146-81021168 CAGGGTCGGGGGCATGGTTCTGG - Intronic
1120297209 14:82657452-82657474 TATGGTAAGAAAAATGGTTCAGG + Intergenic
1120426197 14:84351167-84351189 CAGGTTCAGAAATATCCTTCAGG - Intergenic
1121124431 14:91397081-91397103 CTGTATCAGAAACATGATTCTGG + Intronic
1122659644 14:103286766-103286788 CAAGGTTAGAATTATGGTTCTGG - Intergenic
1122823313 14:104357865-104357887 CAGGGGCAGAGACGTGGGTCTGG - Intergenic
1128607654 15:69048746-69048768 TGGGGTCAGAAACCTGGTTCTGG + Intronic
1128783776 15:70379972-70379994 CTGGGTCAGGACCATGGCTCAGG + Intergenic
1128995653 15:72292501-72292523 CAGGGTCTGAAAAATGGTGATGG + Intronic
1130913066 15:88284233-88284255 TAGGGTCAGAAACAGGCTTGTGG - Intergenic
1132481581 16:168894-168916 GAAGGTCAGGAACATGCTTCAGG - Intergenic
1133316463 16:4887560-4887582 CAGGGTCAGAACCATGGATCTGG - Intronic
1133478406 16:6146104-6146126 AAGGGTCAGAAAGGTGCTTCAGG - Intronic
1133814431 16:9185635-9185657 CAGGTTCAGAAACATGTTTCAGG - Intergenic
1134779704 16:16884665-16884687 CAATGTCAGACAGATGGTTCGGG - Intergenic
1137384970 16:48033088-48033110 AAGTGTCAAGAACATGGTTCTGG - Intergenic
1140111504 16:72009028-72009050 CAGGCTCAAAAACATGGCCCAGG - Intronic
1140776128 16:78250266-78250288 CAGGGTCACAAGCTCGGTTCTGG + Intronic
1141618423 16:85223199-85223221 AAGGGTTAAAAACATGGTTCTGG - Intergenic
1142467014 17:141869-141891 CAGGGTCAGAGTCAGGGTTAGGG - Intergenic
1142600713 17:1052350-1052372 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600730 17:1052394-1052416 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600747 17:1052438-1052460 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600764 17:1052482-1052504 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600799 17:1052570-1052592 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600817 17:1052614-1052636 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600835 17:1052658-1052680 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600852 17:1052702-1052724 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600868 17:1052746-1052768 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600885 17:1052790-1052812 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600902 17:1052834-1052856 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600920 17:1052878-1052900 CAGGGTCAGAGGGAGGGTTCAGG + Intronic
1142600936 17:1052922-1052944 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600952 17:1052966-1052988 CAGGGTCAGAGCGAGGGTTCCGG + Intronic
1142600969 17:1053010-1053032 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600986 17:1053054-1053076 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601004 17:1053098-1053120 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601022 17:1053142-1053164 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601040 17:1053186-1053208 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601057 17:1053230-1053252 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601074 17:1053274-1053296 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601106 17:1053362-1053384 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601122 17:1053406-1053428 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601133 17:1053449-1053471 CAGGGTCAGAGCGAGGGTTCCGG + Intronic
1142896864 17:2985687-2985709 CACTTTGAGAAACATGGTTCTGG - Intronic
1143504839 17:7357969-7357991 CAGGGTTAGAATCATTGTTTGGG + Intergenic
1145821933 17:27844930-27844952 CAGGGTCAGAAACTTTGTGAGGG - Intronic
1146508233 17:33423860-33423882 CAGGGGCAGCAAGAAGGTTCAGG + Intronic
1148091045 17:45022649-45022671 CAGGCTCAGAAAGATGGATTTGG - Intergenic
1148780969 17:50121616-50121638 CATGGTCAGAAATGTGCTTCAGG - Intronic
1149400572 17:56291755-56291777 CAGCTTCTGACACATGGTTCAGG + Intronic
1152179797 17:78812128-78812150 CAGTGGCACAATCATGGTTCAGG - Intronic
1155013986 18:21813883-21813905 CAGGGACAGACACATGGTCTTGG + Intronic
1155850880 18:30772686-30772708 CATGGTCAGAAACACTGTACAGG - Intergenic
1157536166 18:48459236-48459258 CAGTGGCAGCAGCATGGTTCAGG - Intergenic
1158207308 18:55007598-55007620 GGGGGTCAGAAACATGGATAAGG + Intergenic
1158263463 18:55634561-55634583 CATGGTCAGAAAGATAGTTTGGG + Intronic
1159199608 18:65167062-65167084 CAGGGTCAGAGACCTGCTTGAGG - Intergenic
1159621291 18:70641654-70641676 CAGGGTCAGAAATATGTCTGTGG - Intronic
1159936908 18:74376240-74376262 CAGGGTGATAAACATGGGTAGGG + Intergenic
1160613655 18:80108395-80108417 CAGGGTCAGAATTAGGGTTAAGG + Intergenic
1163642213 19:18468314-18468336 CAGGGTCACCCACATGGCTCTGG - Intronic
1164250385 19:23470492-23470514 CAGCGTCAGGAAGATGTTTCTGG - Intergenic
1164745430 19:30609278-30609300 CAGGGTCAAATATATGATTCAGG + Intronic
1167459673 19:49618225-49618247 CAGGGGCAGAAACAGGGCTTGGG - Intronic
925283821 2:2703210-2703232 CAGGGTCACAAAACTGGTTTTGG + Intergenic
930589300 2:53308287-53308309 CAGGGTCAGAAAGATTTTTCAGG - Intergenic
931076766 2:58724166-58724188 CAGGGTGAGGAACATGGTACTGG + Intergenic
931201199 2:60098836-60098858 CAGGCTGAGAAACAGAGTTCTGG + Intergenic
931231548 2:60379378-60379400 CAGTGTCAGAGCCATGATTCAGG + Intergenic
933793218 2:85900004-85900026 CAGAGTCAGAAAAATAGGTCAGG - Intergenic
935427973 2:102940933-102940955 CAGGGTCAGACGCATGGGTATGG + Intergenic
936309792 2:111374837-111374859 CAGGGTCCAAACCAGGGTTCTGG + Intergenic
936571907 2:113624662-113624684 CAGGGTCAGAGTCATGGTTAGGG - Intergenic
947397691 2:229702615-229702637 CAGGTTAAGAATCCTGGTTCTGG + Intronic
948079862 2:235197069-235197091 CAGGGTCAGACACCTCTTTCTGG - Intergenic
949008307 2:241663488-241663510 CAGGTTCAGATACATAGTTACGG - Intronic
1170153579 20:13249741-13249763 GAGGCTGAGAAAAATGGTTCAGG - Intronic
1170533446 20:17316721-17316743 CAGTATCAGAAACATGGGGCTGG - Intronic
1171364607 20:24615424-24615446 CTGGGTCAGGAGCTTGGTTCTGG - Intronic
1173558515 20:43985094-43985116 GAGGGTCAGGATCCTGGTTCCGG + Intronic
1175371436 20:58495666-58495688 CGGGGTCAGAGACATGTTTGGGG + Intronic
1175399281 20:58691891-58691913 CAGGGTCAGATGCAAGGGTCAGG - Intronic
1175653601 20:60750052-60750074 CAGGGACAGAGACATGGAGCAGG - Intergenic
1178422282 21:32452287-32452309 CTGGGTCAGAAACCTCGGTCTGG - Intronic
1180022371 21:45136494-45136516 CAGGTTCTGAAACATGGTGCCGG - Intronic
1182100260 22:27652753-27652775 CAGGGTCAGGAACAAGGTGCAGG + Intergenic
1183178915 22:36245391-36245413 CAGGGGCAGAACCAGGGGTCAGG + Intergenic
1185317771 22:50186227-50186249 CAGGGTCAGATTCAGGGTTTGGG + Intronic
1185428287 22:50786216-50786238 CAGGGTCAGAGTCATGGTTAGGG + Intergenic
950016494 3:9758333-9758355 CAGGGACAGAAACATGTTTTGGG - Intronic
950201117 3:11044813-11044835 CATGGTCACAAACATGGCACAGG + Intergenic
955809294 3:62769742-62769764 CAGGGGCAGAATCATGAGTCAGG + Intronic
956145319 3:66186012-66186034 CAGGGTCAGAATCATGGACAGGG - Intronic
956406630 3:68934543-68934565 CTGTGTGACAAACATGGTTCTGG + Intergenic
959890334 3:111547787-111547809 CAGTGTTAGAGAAATGGTTCTGG + Intronic
962166496 3:133054727-133054749 CAGGGTAAGAATGATGGTCCTGG + Intronic
962363434 3:134760674-134760696 GAGGTTAAGAAACTTGGTTCAGG + Intronic
962745462 3:138394681-138394703 CTGGGTGAGAAACAGGGTTTGGG - Intronic
963008563 3:140749022-140749044 CAGAGTCAGAGGCAGGGTTCTGG - Intergenic
965717681 3:171624930-171624952 CAGGGTGAAAAAGATGGTTGGGG + Intronic
966130201 3:176628870-176628892 TAGGCTCAGAAACATGGTGAAGG + Intergenic
967312558 3:188119846-188119868 GAAGAGCAGAAACATGGTTCTGG - Intergenic
967512231 3:190324693-190324715 CAGCCTCACAAACATGGTTGTGG - Intronic
968994422 4:3936716-3936738 CAGGGACAGGAACATGCTGCAGG - Intergenic
974258046 4:59487661-59487683 AAGGGACAGAAACATAGTCCAGG + Intergenic
974355344 4:60805809-60805831 CAGGATCAGAGACATGTCTCAGG - Intergenic
976768154 4:88620365-88620387 CAGGGTAAGAAACAGGTTTAAGG - Intronic
978180771 4:105792482-105792504 CAGGGTCAGAAACATTGACCTGG + Intronic
978788657 4:112637907-112637929 CAGGTTAAGAATCATTGTTCTGG - Intronic
980665263 4:135925302-135925324 TAAGGTAAGAAAAATGGTTCAGG + Intergenic
985064334 4:186105567-186105589 CAGCGTAAGGAACAGGGTTCTGG - Intronic
990517072 5:56540234-56540256 CAGGGTAATAAACATTTTTCAGG + Intronic
990947342 5:61262879-61262901 CAGGGTCAGACACAAGCCTCAGG + Intergenic
991027466 5:62045611-62045633 CAAGGTTAGAATTATGGTTCAGG - Intergenic
991187935 5:63832353-63832375 CTAGATCAGAAACATGGTGCGGG + Intergenic
991622503 5:68559423-68559445 CAGGGTCAGGGAGATGGTTTGGG - Intergenic
992427337 5:76671400-76671422 CAGGCCCAGAACCATGGCTCAGG + Intronic
992553230 5:77879288-77879310 AAGGGTCAGAAGCAAGGTTTGGG - Intergenic
994039145 5:95237880-95237902 CAGAGTCAAAAACAAGGCTCTGG - Intronic
994522987 5:100865045-100865067 CAGGGACATAACCATTGTTCGGG - Intronic
995782554 5:115793933-115793955 CAGGGTCAGATAAATGTTTTTGG + Intergenic
998655152 5:144170592-144170614 CAGGGTCTGAAACAGAGTTTGGG - Exonic
999231040 5:150061898-150061920 GGGGGTCAGAAACAAGGTCCAGG - Intronic
1001615744 5:173042204-173042226 CAAGGTCAGAATTATGGTCCAGG - Intergenic
1001958145 5:175862483-175862505 AAAGTTCAGAAACATGGTTGAGG + Intronic
1002928065 6:1616446-1616468 CCGGGTCAGAAACAAGGGTCAGG + Intergenic
1003463512 6:6354200-6354222 CAGGTTGAGTAACATGCTTCAGG + Intergenic
1003568643 6:7241423-7241445 CAGGGACAGCATCATGGTGCTGG + Intronic
1003693074 6:8374063-8374085 CAAGGTTAGAATTATGGTTCAGG - Intergenic
1003770900 6:9298802-9298824 CGGGGTAAGAAACATAGCTCAGG - Intergenic
1003991320 6:11489355-11489377 CAGGATCAGAAATATGCTTCAGG - Intergenic
1004141155 6:13018933-13018955 CAGAGGCAAAATCATGGTTCAGG + Intronic
1006928034 6:37669599-37669621 CAGGGTCAGAAACATGGTTCTGG - Intronic
1007071499 6:39041526-39041548 CAGGGTCAGAAAAACGATTCTGG - Intergenic
1008196327 6:48525994-48526016 CAGGCTTAGAGACGTGGTTCTGG + Intergenic
1009846522 6:69141950-69141972 AAGGGTCACAGACATGGCTCAGG + Intronic
1010010851 6:71046463-71046485 TAGGGTCAGACACATGGTTGTGG + Intergenic
1011768611 6:90651624-90651646 CAGGTTAAGAAACATGGTTGTGG + Intergenic
1011811489 6:91137228-91137250 CACTGTCAGAAACATAGTACTGG - Intergenic
1012713977 6:102645764-102645786 CAGTAACCGAAACATGGTTCTGG - Intergenic
1013399832 6:109782209-109782231 CTGGGTCAGAAACCTGCTTTGGG - Intronic
1014086116 6:117346206-117346228 AAGTGTCAGAAACATTATTCAGG + Intronic
1014830489 6:126097592-126097614 AAGTGTCTGAAGCATGGTTCAGG + Intergenic
1015130457 6:129803345-129803367 AAGGGACAAAGACATGGTTCAGG + Intergenic
1015259083 6:131213991-131214013 CAGAGGAAGAAACATGGCTCTGG - Intronic
1017148906 6:151260565-151260587 CAGGGTCTGAAACAAGGGGCTGG - Intronic
1018453130 6:163927485-163927507 CAGGGTCAGGTACATGCATCAGG + Intergenic
1020817405 7:12922643-12922665 GAAGTTCAGAAACATGATTCTGG - Intergenic
1023991905 7:45133547-45133569 CAGGGTCACAACCCTGGTGCAGG + Intergenic
1024140321 7:46456390-46456412 CAGGGTCAGAAAAATGCTTAAGG + Intergenic
1024915352 7:54493015-54493037 GAGGGACAGAAACACAGTTCAGG - Intergenic
1025610580 7:63072788-63072810 CAGGGTCAGGAACAAGGTCAGGG + Intergenic
1028324221 7:89502316-89502338 CAGGATCAGAAGCATGGGTGGGG - Intergenic
1028799475 7:94946442-94946464 CATAGTCAGAATCATGGTTTAGG + Intronic
1029949352 7:104566589-104566611 AAGGGTCAGACTCATGGTACGGG - Intronic
1030819822 7:114082963-114082985 CAGGGTCATAGGCACGGTTCAGG - Intergenic
1031843484 7:126775794-126775816 CAGGATTAGTGACATGGTTCAGG - Intronic
1034051563 7:147989554-147989576 CAGGGACAGGAACATGGAGCAGG - Intronic
1039733333 8:40303731-40303753 CAGGGTCAGAGACATGGTTTGGG + Intergenic
1042599740 8:70487291-70487313 CAGGGTCTGAGACATGCTCCAGG + Intergenic
1046145054 8:110147766-110147788 CAGGGACAGGAACAAGGTCCAGG - Intergenic
1046798339 8:118396954-118396976 AAGGGTGAGACACATGTTTCTGG + Intronic
1046802883 8:118448547-118448569 GAGTGTCAGAAAACTGGTTCAGG + Intronic
1047402748 8:124559927-124559949 AAGGGACAGAAATATGATTCTGG - Intronic
1047543671 8:125795390-125795412 CAGGGGCAGAATCTTGATTCTGG - Intergenic
1048871691 8:138804264-138804286 CAGGGTCCTAACCATGGTTTGGG + Intronic
1049465078 8:142747460-142747482 CAGGGTCAGAACCAAGGCTGCGG - Intergenic
1050693996 9:8259412-8259434 CAGGGGCAGAAACTTGGTTTGGG - Intergenic
1050891897 9:10835209-10835231 CAGGGTCTGAAACATGGTTCAGG - Intergenic
1052994143 9:34540891-34540913 CAGGGTCAGGAAGATGGCTGTGG + Intergenic
1056735574 9:89206651-89206673 CAAGGTTAGAATTATGGTTCAGG - Intergenic
1058041182 9:100303613-100303635 CACGGTAAGAAGCATGGTACCGG - Exonic
1060205901 9:121682762-121682784 CAGGGCCTGAAACCTGGGTCGGG - Intronic
1186700775 X:12087452-12087474 CAGGGTCAGCATCAAGATTCAGG + Intergenic
1188033762 X:25294066-25294088 TAGGGGAAGAAACCTGGTTCAGG - Intergenic