ID: 1006928245

View in Genome Browser
Species Human (GRCh38)
Location 6:37671272-37671294
Sequence TACACAGATGTGTTTACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006928245_1006928247 12 Left 1006928245 6:37671272-37671294 CCTGCAGTAAACACATCTGTGTA 0: 1
1: 1
2: 1
3: 25
4: 202
Right 1006928247 6:37671307-37671329 TCAGTGCTTTCTAAACGTATTGG 0: 1
1: 0
2: 1
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006928245 Original CRISPR TACACAGATGTGTTTACTGC AGG (reversed) Intronic
901442872 1:9290148-9290170 TACAAAGATCTGTGTACTGCAGG - Intergenic
904331979 1:29765554-29765576 TACACACATATGTTTATTGCAGG + Intergenic
905179983 1:36159689-36159711 AAGGCAGATGTGTTCACTGCAGG + Intronic
905388109 1:37618287-37618309 TAAACAGATTTCTTTACTGCAGG + Intronic
911083813 1:93959512-93959534 TACATAGATGTCTTTTCTTCTGG + Intergenic
911730610 1:101288629-101288651 TACACAGATTTCTTTGGTGCTGG - Intergenic
913189996 1:116405425-116405447 GAAAGAGATGTGTTTACTTCAGG + Intronic
918337678 1:183536190-183536212 TAGACAGATGAGTCTACTGTAGG + Intronic
919273018 1:195375587-195375609 ACCACAGAAGTGGTTACTGCAGG + Intergenic
922466119 1:225846415-225846437 TACAGAGATGTGTGCACAGCTGG + Exonic
923654484 1:235903880-235903902 TGCACACATATGTTTATTGCAGG + Intergenic
923966353 1:239144051-239144073 TACACACATGTACATACTGCAGG + Intergenic
924421779 1:243916824-243916846 AACATAGATGTGTTTACGGCAGG + Intergenic
1064066944 10:12190421-12190443 TACACAGACGTTTCCACTGCTGG - Intronic
1065554556 10:26902263-26902285 TGCACACATATGTTTATTGCAGG + Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1068460035 10:57317182-57317204 TAAACAGATGTGTTTAAATCAGG + Intergenic
1068911737 10:62385732-62385754 AACACAAATGTGTTGAGTGCTGG + Intronic
1069326483 10:67237025-67237047 TACACACATATGTTTACAGCAGG + Intronic
1072851990 10:98905613-98905635 TAACCAGTTGTGTTTAATGCTGG - Intronic
1072860946 10:99005876-99005898 TCCATAGGTGGGTTTACTGCTGG + Intronic
1075658644 10:124177942-124177964 TAGACAGATGTGTAAACAGCAGG + Intergenic
1076032271 10:127169750-127169772 TGGACATCTGTGTTTACTGCAGG - Intronic
1076257243 10:129037392-129037414 CCCACATATGTGTTTACTTCTGG - Intergenic
1076273944 10:129180816-129180838 TCCACAGATTTCTTTTCTGCAGG - Intergenic
1077819272 11:5720013-5720035 GACACAGATGTGTGTGGTGCAGG - Intronic
1079722738 11:23839057-23839079 TACAGATTTTTGTTTACTGCAGG + Intergenic
1080269989 11:30440960-30440982 TAAAGAGGTGTCTTTACTGCAGG + Intronic
1080610577 11:33900515-33900537 TAAACAGAGATGTTTACTGTGGG - Intergenic
1081829043 11:46090566-46090588 TAAACAGGTTTCTTTACTGCAGG - Intronic
1082199974 11:49354497-49354519 TAAACAGATGTGTTTTCATCTGG + Intergenic
1085802219 11:79601173-79601195 AAAACAGATGGGTGTACTGCTGG + Intergenic
1086450955 11:86916437-86916459 TCCACAGATTTGGTTTCTGCTGG - Intronic
1086655696 11:89351700-89351722 TAAACAGATGTGTTTTCGTCTGG - Intronic
1087980344 11:104605457-104605479 TGCACACATATGTTTATTGCAGG + Intergenic
1088161819 11:106880700-106880722 TACATAGATTTCTTTACTGTAGG + Intronic
1089939605 11:122401957-122401979 TGCACACATGTGTTCATTGCAGG + Intergenic
1091532689 12:1374777-1374799 TACACAGATGTGTTATAGGCAGG + Intronic
1091609366 12:1990870-1990892 TACACAGAAGGGTTTACCACAGG - Intronic
1092305339 12:7294876-7294898 TACACAGATGTCTAAACAGCTGG + Intergenic
1092533225 12:9362342-9362364 GACATCGATGTGTTTAATGCAGG + Intergenic
1093144103 12:15543918-15543940 CACACAGATGTGTTGCCTCCTGG - Intronic
1094585195 12:31771344-31771366 TACCTAGATGTGTTTGCTGAAGG + Intergenic
1094669044 12:32550909-32550931 TACGCAGCTGAATTTACTGCAGG - Intronic
1096766478 12:53894755-53894777 TCCACAGAAGTCTTTACGGCAGG + Intergenic
1097836492 12:64278209-64278231 TCATCAGATGTGTTTACTACAGG + Intronic
1099784660 12:87245760-87245782 TACACAGATGATTTAACTTCAGG - Intergenic
1102441459 12:112967051-112967073 TACACAGCTCTGTTACCTGCAGG + Intronic
1102889155 12:116544636-116544658 TACCCAGATGTCTCTACTTCAGG + Intergenic
1103090326 12:118093507-118093529 TACACATATGGATTTACAGCAGG - Intronic
1104814689 12:131638929-131638951 CACACAGGTGTATTTTCTGCCGG - Intergenic
1106905891 13:34408511-34408533 TGCTCAGCTGTGTCTACTGCAGG + Intergenic
1107915678 13:45147687-45147709 TCCGCAGATTTGTTTACTGTAGG - Intronic
1109552123 13:63917503-63917525 CCCACAGATGTGTTTGCTGTGGG - Intergenic
1109753029 13:66721392-66721414 TAAACAGATATCTTTACTGCAGG - Intronic
1112408227 13:99139505-99139527 TACACAGATGTCTAAACAGCTGG - Intergenic
1116262028 14:42642510-42642532 AGCACAGATGTGGTTACTTCTGG - Intergenic
1116639479 14:47442709-47442731 TACACAGATGTGGTATCCGCAGG - Intronic
1117046635 14:51819070-51819092 GACACAGATCTGCTCACTGCAGG - Intergenic
1117981795 14:61348969-61348991 GACACAGAAGTGTTCCCTGCTGG + Intronic
1120019890 14:79516466-79516488 TGCACAGATGTGTTTTCATCTGG + Intronic
1124667574 15:31606602-31606624 TACACAGATGAATTTGGTGCAGG - Intronic
1126363248 15:47867849-47867871 TGCACACGTGTGTTTATTGCAGG - Intergenic
1126822376 15:52517333-52517355 TACCAAAATGTATTTACTGCTGG - Intronic
1128692841 15:69738380-69738402 TAGACAGGTTTATTTACTGCAGG - Intergenic
1129369617 15:75082204-75082226 TAAACGTATGTGTTTACTTCTGG - Intronic
1130006046 15:80099512-80099534 AACACAAATGTGTTGACTGAAGG + Intronic
1130153924 15:81333426-81333448 TAAACAGTTTTCTTTACTGCTGG + Intronic
1130858255 15:87861398-87861420 TACACTGATTTGTTTCCTACTGG - Intronic
1131440774 15:92457975-92457997 TACAAAGCTGTGTGCACTGCTGG + Intronic
1132860785 16:2070755-2070777 GCCACAGATGTGTGGACTGCAGG - Intronic
1136564150 16:31060107-31060129 TAAACAGATGTGTTCACTGCTGG + Intergenic
1137999041 16:53254704-53254726 TAAACACATTTGTTTTCTGCAGG + Intronic
1139223847 16:65214788-65214810 TATACACATTTATTTACTGCAGG + Intergenic
1142189330 16:88710484-88710506 CTCTCAGATGTGTTTACAGCAGG + Intronic
1142189337 16:88710551-88710573 CTCTCAGATGTGTTTACAGCAGG + Intronic
1142189344 16:88710618-88710640 CTCTCAGATGTGTTTACAGCAGG + Intronic
1143835179 17:9686265-9686287 TGCACTCCTGTGTTTACTGCAGG - Intronic
1146616098 17:34358609-34358631 TACACAGTGGTGTTTTCTTCAGG + Exonic
1150617442 17:66783275-66783297 TAAACAGCTTTGTTCACTGCAGG + Intronic
1151241710 17:72763436-72763458 TATACAGGTGTCTTTGCTGCAGG - Intronic
1152197349 17:78925370-78925392 TCTACGGATGTGTTTGCTGCGGG + Exonic
1153394286 18:4600533-4600555 TGAAAAGATGTCTTTACTGCAGG + Intergenic
1155017689 18:21861798-21861820 TGCACAGATGTGTCTACTTTTGG + Intronic
1155513865 18:26604453-26604475 TGCACACAAATGTTTACTGCAGG + Intronic
1158166880 18:54549932-54549954 TACACAGATGTCTAAACAGCTGG - Intergenic
1158463285 18:57666170-57666192 TACTGTGATGTGTTTACTGATGG - Intronic
1163836409 19:19577391-19577413 TACAAAGATGTATTTACAGGAGG + Intronic
1164974990 19:32566255-32566277 TACACAGATCTGTTTCTTCCTGG - Intergenic
926161319 2:10491713-10491735 TACACATATGAGTTTATTTCTGG - Intergenic
927966969 2:27276366-27276388 GACCCAGAGGTGTTTACTCCAGG + Exonic
928102515 2:28447472-28447494 TTCCCAGGTGTGTTTCCTGCAGG - Intergenic
930045754 2:47170875-47170897 TATCCAGATGTGTTTGTTGCTGG - Intronic
930135135 2:47895571-47895593 TACACAGATGTGTTTACTTCAGG + Intronic
933778204 2:85784581-85784603 CACACAAATTTGTTTACTGCAGG + Intronic
935456706 2:103277699-103277721 TAACCAGATGGTTTTACTGCTGG + Intergenic
941945276 2:171089581-171089603 TTTACAGATGGGTCTACTGCTGG + Intronic
942428991 2:175889431-175889453 TACATAGATGGGTGTGCTGCAGG - Intergenic
944277897 2:197860324-197860346 TGCACACATGTGTTCATTGCAGG - Intronic
944659970 2:201913397-201913419 GGCACAGCTGTGTTTACTCCAGG - Intergenic
946466598 2:219917618-219917640 TTAACAGGTATGTTTACTGCAGG + Intergenic
947879635 2:233495999-233496021 TACACATATTTGTTTGCTGAAGG - Intronic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
948541219 2:238692571-238692593 TGGACACATGTGTTTCCTGCTGG - Intergenic
1169014579 20:2281189-2281211 TAGATAGATGTCTTTACTGCAGG - Intergenic
1180750719 22:18122468-18122490 TGCACAGATGATTTTTCTGCAGG + Intronic
950743775 3:15070603-15070625 TACAGAGATGGGTTGACAGCAGG - Exonic
950952566 3:17016058-17016080 TAATCAGATATCTTTACTGCAGG + Intronic
951408167 3:22326770-22326792 TACACAGATGTATTTAGTCTGGG - Intronic
951497245 3:23343647-23343669 TACACAGATGTGTTCACTTGAGG - Intronic
953142475 3:40241586-40241608 TAAACAGATTTCTTTACTGCAGG - Intronic
953970158 3:47341135-47341157 TAAACAGAGTTATTTACTGCAGG - Intronic
955980997 3:64527907-64527929 TACACATGTGTGTTTATTTCAGG + Intronic
959801543 3:110501042-110501064 TACACATGTATGTTTATTGCAGG + Intergenic
959930434 3:111976486-111976508 TACACAGATACATTTATTGCTGG + Exonic
960047503 3:113212051-113212073 TAAAAAGTTGTGTTTACTGTTGG + Intronic
960347471 3:116552139-116552161 GACAAAGATGTCTTTACTGATGG + Intronic
960382119 3:116975859-116975881 CACACACATGAGTTTACTGTGGG - Intronic
960733134 3:120747694-120747716 TGCACACGTATGTTTACTGCGGG - Intronic
960808035 3:121602872-121602894 CCCAAAGATGTGTTTCCTGCTGG + Intronic
961354147 3:126324016-126324038 TGCACACATATGTTTATTGCAGG - Intergenic
962402187 3:135069949-135069971 CAAACAGATGTCTTTACTGCAGG + Intronic
962587495 3:136857107-136857129 TACCCAGAGGTGATAACTGCAGG - Intergenic
964971742 3:162571684-162571706 TACATAAATGTATTTACTGAAGG - Intergenic
967049282 3:185767474-185767496 TAAACAGATTTCTTTACTACAGG + Intronic
967883910 3:194320501-194320523 AACACAGATGGCTTTTCTGCGGG - Intergenic
968524883 4:1051400-1051422 TAGACAGATGTCATTAATGCTGG - Intergenic
969134868 4:5021398-5021420 GGCACAGATGTGTTTTCTTCTGG + Intergenic
973656893 4:53057204-53057226 TGCACACATATGTTTATTGCAGG + Intronic
975317719 4:72974041-72974063 TAAACAGATTTGTCTACTGTAGG + Intergenic
978019749 4:103792946-103792968 TTCACACATATGTTTATTGCAGG + Intergenic
978188492 4:105885728-105885750 TGCACACATATGTTTATTGCGGG + Intronic
978488474 4:109284033-109284055 TACGCAGATTTATTTACTGTAGG - Intronic
978669135 4:111225095-111225117 TACAATGATCTGTTTACTCCAGG + Intergenic
981678664 4:147368657-147368679 TACACAGATGTATATGCAGCTGG - Intergenic
982488092 4:155993302-155993324 TACACAGATGTGCTTTCATCCGG + Intergenic
984490339 4:180426693-180426715 TAAACACATTTCTTTACTGCAGG + Intergenic
987512003 5:18851559-18851581 TCCACAGAAGTGTTTAATGATGG + Intergenic
987905906 5:24076989-24077011 TAAACAGATGTGTGTTCTGCTGG + Intronic
988707799 5:33742674-33742696 TACAAAGATGTGTCTACTGGTGG + Intronic
990726144 5:58756890-58756912 TGCACACATATGTTTATTGCAGG - Intronic
991348780 5:65699075-65699097 TGCACACATGTGTTTATTGCAGG + Intronic
991637981 5:68725219-68725241 TAAACAGATTTCTTTTCTGCTGG - Intergenic
992251426 5:74879678-74879700 AGCACAGATGGCTTTACTGCTGG - Intergenic
992347013 5:75889547-75889569 TGCACAGATATGTTTATTGCAGG - Intergenic
992383328 5:76259893-76259915 TGCACACATATGTTTATTGCAGG - Intronic
993060314 5:83030485-83030507 AACACTGATGTATTTGCTGCAGG + Intergenic
993605243 5:89982149-89982171 TATGCAGTTGTGTTTACTGTAGG - Intergenic
994446791 5:99885672-99885694 TGCACAGCTGTCTTTAGTGCTGG - Intergenic
994721001 5:103380276-103380298 TGCACAAGTATGTTTACTGCAGG - Intergenic
996156283 5:120106699-120106721 TACACACATGTGTTTACAATCGG - Intergenic
996665234 5:126051083-126051105 TAAATAGATGTGTTGACTGTGGG - Intergenic
1000496101 5:161987357-161987379 TACACAAGTGTGCTTACTTCAGG - Intergenic
1000629156 5:163572133-163572155 TGTACAGAAGTGTTTTCTGCAGG - Intergenic
1001247447 5:170115360-170115382 CACACAGATGTGTTCACTTTAGG + Intergenic
1001318004 5:170657949-170657971 GACACAGATGTGATACCTGCTGG + Intronic
1003385500 6:5663892-5663914 TGCACTGGTGTCTTTACTGCAGG + Intronic
1003679201 6:8235436-8235458 TAGACAGATGTAGCTACTGCTGG + Intergenic
1003934823 6:10964657-10964679 TACACAAACGTGTTTAATGGAGG + Intronic
1004702070 6:18088592-18088614 TAAACAGTTGTCTTTCCTGCAGG + Intergenic
1005478790 6:26234872-26234894 TTCACAGGTGTTTTTTCTGCGGG + Exonic
1006928245 6:37671272-37671294 TACACAGATGTGTTTACTGCAGG - Intronic
1007361978 6:41364622-41364644 TACACAGCTTTGATTCCTGCTGG - Intergenic
1007745403 6:44040217-44040239 CACACAGCTGTGTAGACTGCAGG + Intergenic
1008005859 6:46408286-46408308 TAAACAGCTGTGATGACTGCAGG + Intronic
1008036195 6:46747856-46747878 TACACAGTCCTGATTACTGCAGG - Intronic
1008606243 6:53142435-53142457 TAAACAGATTTCTTGACTGCAGG - Intronic
1009512812 6:64573970-64573992 TACACATGTATGTTTATTGCAGG + Intronic
1012604644 6:101143065-101143087 TGCACACATATGTTTATTGCAGG - Intergenic
1013751242 6:113409035-113409057 TAAGCAGACTTGTTTACTGCAGG - Intergenic
1014608243 6:123506004-123506026 GAAACATATGAGTTTACTGCAGG - Intronic
1014822763 6:126010918-126010940 TACACAGGACTGTTTACTGCTGG + Intronic
1014956187 6:127619451-127619473 TACACATAGGTTTTGACTGCAGG - Intergenic
1016009884 6:139128305-139128327 TAAACAGGTTTCTTTACTGCTGG + Intergenic
1016467351 6:144338957-144338979 TAAACATATGTATTTACTGCAGG + Intronic
1016734489 6:147461834-147461856 TACACACATATGTTTACTGTGGG + Intergenic
1017775445 6:157676766-157676788 TACAGAGAAGCGTTTGCTGCAGG - Exonic
1017872449 6:158498546-158498568 TACACAGATCTGTCTTCTGATGG + Intronic
1018151051 6:160940073-160940095 TAGACAGCTGTGGCTACTGCTGG + Intergenic
1022228184 7:28385319-28385341 TACACATATGGGTCTTCTGCAGG + Intronic
1023219574 7:37905416-37905438 TAGACAGATTTCTTAACTGCTGG - Intronic
1023361650 7:39423089-39423111 TGCTCAGATGTGTTTGCTGCTGG - Intronic
1025222330 7:57124300-57124322 TACACAGAAGAGTTCATTGCTGG - Intronic
1025266600 7:57464884-57464906 TACACAGAAGAGTTCATTGCTGG + Intronic
1025633111 7:63295970-63295992 TACACAGAAGAGTTCATTGCTGG - Intergenic
1025649585 7:63452213-63452235 TACACAGAAGAGTTCATTGCTGG + Intergenic
1025742993 7:64215827-64215849 TACACAGAAGAGTTCATTGCTGG + Intronic
1025748011 7:64262623-64262645 TACACAGAAGAGTTCATTGCTGG + Intronic
1027404681 7:77847179-77847201 TACACAGAAGTGCTTTCTGATGG + Intronic
1027509780 7:79066007-79066029 TACACGTGTATGTTTACTGCGGG - Intronic
1028220713 7:88193499-88193521 TACACTGTTTTGTTTACTGTAGG - Intronic
1030872291 7:114771517-114771539 TATACATATATATTTACTGCAGG + Intergenic
1033475660 7:141689647-141689669 TACACAAATATGTTTACTTTGGG - Intronic
1035309776 7:157959064-157959086 TACACAAAAGGGTTTACTTCTGG - Intronic
1037498181 8:19460999-19461021 TAAATAGCTGTGTTCACTGCTGG - Intronic
1037889910 8:22618595-22618617 TCAGCAGATGTGTTTTCTGCAGG + Exonic
1039370099 8:36975631-36975653 TACCCAGAGGTGTTTATTGCAGG - Intergenic
1041808855 8:61886379-61886401 TCCAAAGGTGGGTTTACTGCTGG + Intergenic
1041978904 8:63832468-63832490 GACAAAGATGAGTTTACTTCAGG + Intergenic
1044712160 8:95068383-95068405 TACAGAGATCCATTTACTGCTGG + Intronic
1045109842 8:98929919-98929941 TAAACAGATGTCTTTACCGTAGG + Intronic
1045234645 8:100340264-100340286 TGCACACATATGTTTACTGCAGG - Intronic
1045855184 8:106756836-106756858 TACACAGATGTCCTGACTGTGGG - Intergenic
1048197084 8:132340305-132340327 TGCACACATATGTTTATTGCAGG + Intronic
1050368381 9:4894984-4895006 TACACAGAGGTGGATATTGCTGG - Intergenic
1050531779 9:6596931-6596953 TACACAGAAGTGTTCACAGCAGG + Intronic
1051591520 9:18780468-18780490 TAAACAGATGTATGTACTGCTGG + Intronic
1051994023 9:23192126-23192148 TAAACAGCTGTGTTTGCTTCAGG - Intergenic
1052420717 9:28240493-28240515 GTCAAAAATGTGTTTACTGCAGG - Intronic
1052674019 9:31596020-31596042 TAGACACATCTGTTTACTACCGG + Intergenic
1052800556 9:32963500-32963522 TGCACACATATGTTTATTGCAGG + Intergenic
1055782781 9:79837503-79837525 TGCACACATATGTTCACTGCAGG - Intergenic
1057610827 9:96542299-96542321 TACACACATATGTTTATTACAGG - Intronic
1057844641 9:98513951-98513973 TGCACACATGTGTTTATTGCGGG + Intronic
1058532947 9:105925025-105925047 GAGGCAGATGGGTTTACTGCTGG + Intergenic
1059326929 9:113509454-113509476 TGCACAGATGTCTCTGCTGCTGG + Intronic
1061364006 9:130161253-130161275 AACACAGATTTCTTTCCTGCAGG + Intergenic
1186182905 X:6990324-6990346 TAGACAGATGTGTTCAATGGAGG - Intergenic
1186660192 X:11661746-11661768 CCCACAGAAGTGTTTACAGCTGG - Intronic
1187701902 X:21970869-21970891 TACACAGATGTGTTATTTCCAGG - Intronic
1188695541 X:33185910-33185932 TAAACAGCTGTCTTTCCTGCAGG + Intronic
1190633856 X:52415366-52415388 TTCACAAATTTGTTTACTGAGGG - Intergenic
1191111506 X:56806266-56806288 TGCACACATATGTTTACTGCGGG - Intergenic
1191154950 X:57264726-57264748 TGCACACATGTGTTCATTGCAGG + Intergenic
1193034315 X:76933281-76933303 TGCACACGTGTGTTTATTGCAGG + Intergenic
1197891032 X:131270588-131270610 TACAGAGATGTGTTTTGTGGGGG - Intergenic
1198139113 X:133785005-133785027 TCCACTGATCTGTTTCCTGCAGG - Intronic
1198724793 X:139665524-139665546 TGCAGAGATGTGGCTACTGCAGG + Intronic
1202015046 Y:20396079-20396101 TACACAGATGTAATAAATGCAGG + Intergenic
1202043448 Y:20712229-20712251 TGCACATATATGTTTATTGCAGG + Intergenic