ID: 1006929425

View in Genome Browser
Species Human (GRCh38)
Location 6:37678738-37678760
Sequence CTCAGAAGACAGCTGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 378}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006929425 Original CRISPR CTCAGAAGACAGCTGAAGGA AGG (reversed) Intronic
901727103 1:11250472-11250494 CTGAGAAGCCAGGTGAAGAAAGG - Intronic
903023791 1:20412612-20412634 CTCAGTAAACAGCTGATGAATGG - Intergenic
903471074 1:23587893-23587915 CTCCGGAGAGAGCTGAATGAAGG + Intronic
903671344 1:25037643-25037665 CTCAAAAAACAGCTGACAGATGG + Intergenic
905129037 1:35738490-35738512 GTCAGAAGCCAGGTGGAGGAAGG - Exonic
905616560 1:39404805-39404827 CTAAGTAGAGAGCTGAAGGCAGG - Intronic
907354474 1:53861233-53861255 CCCAGAAAACAGCTGCTGGAAGG - Intronic
907462363 1:54612498-54612520 CTCAGCAGCCAGCTGAAGTGGGG + Exonic
908193786 1:61729106-61729128 CTCAGAATAGGGCTGAGGGATGG - Intergenic
908199959 1:61784317-61784339 CACAGAAGACAGGTTATGGACGG + Intronic
909249020 1:73327836-73327858 CACAGAAGAAAGCTGAATCATGG + Intergenic
909405179 1:75281105-75281127 CTCAGAAGACAGGTAGAGGTGGG + Intronic
910672132 1:89784060-89784082 CTCAGGAGGCAGAGGAAGGATGG + Intronic
913083543 1:115412856-115412878 CTGGGAAGGCAGCTGAAGAATGG + Intergenic
913501613 1:119477214-119477236 CTCTGAAGGCAACTGAAGGAAGG - Intergenic
914355762 1:146882791-146882813 TTCAGATGAGAGCTGAAGAATGG - Intergenic
915043102 1:152984917-152984939 CTCAGAAGCCAGCTTTAGTAGGG + Intergenic
915396568 1:155589713-155589735 CTCAGGAGAAAGATGAAGGCTGG + Intergenic
915412368 1:155711917-155711939 CTCAGGAGAAAGATGAAGGCTGG + Intronic
917518110 1:175724937-175724959 CTCAGAAAACAGCTCAAGTGTGG + Intronic
920038933 1:203083698-203083720 CTAAGGAGGCAGCTGAATGAGGG + Exonic
920819261 1:209365098-209365120 CACAGAAGAAAGGTTAAGGAAGG - Intergenic
921431476 1:215070756-215070778 CTAATAGGACAGCTGAAGGAAGG - Intronic
921739384 1:218666489-218666511 GTCAGAAGACATATGAATGAGGG + Intergenic
921780481 1:219157175-219157197 CTCAGAATACAGGAGATGGAGGG - Intergenic
922225800 1:223645186-223645208 CGCAGAAGAAAGATGAAGGCCGG + Intronic
922227319 1:223656610-223656632 ATCAGAAGACAGCTTCTGGAGGG - Intronic
922588462 1:226753796-226753818 CTGAGCAGAGATCTGAAGGATGG + Intergenic
922901391 1:229139338-229139360 TTCAGGAGAGAGCTGAAGGAGGG + Intergenic
922934212 1:229411289-229411311 CTCTGCAGACAGCTGCAGGCAGG + Intergenic
1063337687 10:5232312-5232334 CTCAGAAGATAGCAGAGGAAAGG + Intergenic
1063715228 10:8520359-8520381 CCCAGAAGACAGCAGCAGGTTGG - Intergenic
1063910460 10:10824509-10824531 CTCAGATGAGCACTGAAGGATGG - Intergenic
1064038522 10:11936633-11936655 CTCAAAAGCCAGCTGAGGAAAGG - Exonic
1064576175 10:16748392-16748414 CTCCTAAGACAGAGGAAGGAGGG - Intronic
1065173769 10:23057232-23057254 CACAGGAGAAAGCTGAAGGCTGG + Intergenic
1065725712 10:28666149-28666171 CACAGAAGACAGCTGTAAGTAGG - Intergenic
1067008616 10:42690220-42690242 CTCAGGTGCCAGCAGAAGGATGG + Intergenic
1067730569 10:48807937-48807959 CTCAGAGGACAGATGAAGCTGGG - Exonic
1069210291 10:65749579-65749601 TTGAGAAGACAGCTGGGGGAGGG + Intergenic
1070082860 10:73205992-73206014 CTCAGAAGACAACAGGAAGAGGG + Intronic
1070645856 10:78202022-78202044 CAGAGAAAAGAGCTGAAGGACGG + Intergenic
1070744057 10:78922131-78922153 CTCAGCAGAGAGCTGGAGGCAGG + Intergenic
1070811025 10:79298221-79298243 CTCAGAAGACAGCCCTGGGAAGG - Intronic
1070987803 10:80703204-80703226 CTAAGATGACAGATAAAGGAAGG - Intergenic
1071996721 10:91156448-91156470 CTCAGAAGACAATTTAAGAAAGG - Intergenic
1073479246 10:103775841-103775863 TTCAGAACCCAGCTCAAGGACGG + Intronic
1074050572 10:109877673-109877695 CTCAACAGACAGATGAAGGTGGG + Intronic
1074419187 10:113294034-113294056 CTCAGAAGAGAACTGAAGGAGGG + Intergenic
1074536862 10:114334289-114334311 CTCTGAAGACTTCTGAAGAAAGG - Intronic
1074915383 10:117950431-117950453 TTTCAAAGACAGCTGAAGGAAGG - Intergenic
1075799280 10:125142793-125142815 CCCAGAAGACACCAGGAGGAAGG + Intronic
1076140723 10:128077020-128077042 CTGAGAAGGCACCTGGAGGAGGG - Intronic
1076909547 10:133380053-133380075 CTCAGCAGCCAGCTGGAAGACGG - Exonic
1079551457 11:21703951-21703973 CTCAGAAAACTACTGAAGAAAGG - Intergenic
1080247983 11:30201027-30201049 CTCAGAGAGCATCTGAAGGAGGG + Intergenic
1080597334 11:33785195-33785217 GTCAGATGACAGCTGAAAGAAGG + Intergenic
1080690917 11:34556996-34557018 TTCACATGACAGTTGAAGGAGGG - Intergenic
1084690886 11:70725784-70725806 CTCTGAAGACAACTGAAAGATGG + Intronic
1085011560 11:73144822-73144844 CTAAGAAGAGAGGTGAAGGGAGG - Intergenic
1085265248 11:75234081-75234103 CTGAGAAGCCAGCTGAGGGGTGG + Intergenic
1085528213 11:77176165-77176187 CTCCAAGGACAGCTGCAGGAGGG + Intronic
1086013442 11:82134231-82134253 ATGAGAAGAAAGCTGAATGAAGG - Intergenic
1087577266 11:100004840-100004862 ATAAGAACACAGCTGAAGAAAGG + Intronic
1087608756 11:100409104-100409126 CGCAGAAGACAGCAGAAGACGGG + Intergenic
1087622215 11:100555152-100555174 TTGAGAAAACAGCAGAAGGAAGG + Intergenic
1088963039 11:114689998-114690020 TCCTGAAGACAGCAGAAGGATGG + Intronic
1089209726 11:116791869-116791891 CTGAGAAGACAGGTGGAGGGAGG + Exonic
1089752774 11:120663086-120663108 TTCAGAAGATAGATGATGGAAGG - Intronic
1091131240 11:133148839-133148861 CTTAGATGACAGCTGAAAAAGGG + Intronic
1091513835 12:1157717-1157739 CTCAGAAGTCAAGTGAAGAAAGG + Intronic
1091650287 12:2304276-2304298 CCCAGAAGAAAGCTGGAGGGCGG + Intronic
1091921132 12:4305819-4305841 CTCAGAAGAGGGGTGCAGGAAGG - Intergenic
1092161164 12:6316244-6316266 CTCAGCTGACACCTGGAGGAGGG - Exonic
1092265628 12:6978285-6978307 CTGGGAAGACAGTGGAAGGAAGG + Intronic
1093581258 12:20786257-20786279 CTCAGAAGACAGGAAAAGGTGGG + Intergenic
1093837111 12:23846113-23846135 CTCAGAAGGCAGAAGAAGGTGGG - Exonic
1095694097 12:45124850-45124872 CACAGCACACAGCTGTAGGAAGG + Intergenic
1100297997 12:93280535-93280557 CACAGAAGCCAGGTGAAGGTAGG + Intergenic
1100516290 12:95331198-95331220 CTCAGAAGAAACCAGAGGGATGG + Intergenic
1100571536 12:95847613-95847635 CACAGAAGACAGCTTAATGGGGG + Intergenic
1100899847 12:99225642-99225664 CACAGGAGACAGATGAAGGCCGG - Intronic
1101340461 12:103838311-103838333 CGCATGAGACAGCTGAAGCATGG - Intronic
1101742811 12:107514155-107514177 CACAGAGGGCAGCTGCAGGATGG + Intronic
1102456524 12:113074286-113074308 CTCAGAGGACAGCAATAGGAGGG + Intronic
1102541457 12:113622383-113622405 GGCCGAAGAGAGCTGAAGGAAGG - Intergenic
1105444363 13:20439903-20439925 CTGAGAAAACAGCGGAAGCAGGG + Intronic
1108321940 13:49298249-49298271 TTAAGAAGACACCTGCAGGAAGG + Intergenic
1108940394 13:55946644-55946666 TGCAGGAGACAGATGAAGGAAGG + Intergenic
1109896493 13:68698255-68698277 TTCATAAGTCAGCAGAAGGAAGG + Intergenic
1110198034 13:72813320-72813342 GCCAGAAGACAGCTGAGAGAGGG - Intronic
1110552573 13:76825559-76825581 CTCAGAAATCAGATGAAGAAGGG - Intergenic
1110676824 13:78258023-78258045 CTCAGATGACATCTAAAAGAAGG - Intergenic
1110999697 13:82164361-82164383 CCAAGAAGACACCAGAAGGAAGG - Intergenic
1112249288 13:97764448-97764470 CTCAGAAGAACACTGCAGGAGGG + Intergenic
1112848793 13:103677790-103677812 CTCAGGAGAGCGCTGAAGGTAGG + Intergenic
1114562990 14:23606939-23606961 CTCACAAGACAGCTCTTGGAGGG + Intergenic
1114565240 14:23627029-23627051 CTCAGAAGAAACAAGAAGGATGG + Intergenic
1115546149 14:34466444-34466466 CTCAGGAGACAGGTGGATGAAGG + Intergenic
1117915399 14:60672772-60672794 CACAGATGACAGCAAAAGGATGG - Intergenic
1119116074 14:72022806-72022828 ACCAGAAGACAGGTGAAGTACGG - Intronic
1119651725 14:76388678-76388700 CACAGGAGAAAGCTGTAGGAAGG + Intronic
1120051206 14:79868457-79868479 GCCACAAGAAAGCTGAAGGATGG - Intergenic
1120406972 14:84102590-84102612 CTCAGAAGACAGGACAATGAGGG + Intergenic
1120930712 14:89845600-89845622 CTTACAAGAGAGCTGAAGAATGG - Intronic
1121104562 14:91271969-91271991 CTCAGGAGCCAGCTGGAGGCTGG + Exonic
1121226798 14:92327215-92327237 CTCAGAAGGCATCTGAGGGCAGG - Intronic
1121775776 14:96589663-96589685 CTCAGAAGGCAGCTGCAAGAGGG + Intergenic
1122724481 14:103741274-103741296 CTAAGAAGGCAGCTGAGAGAAGG - Intronic
1122765870 14:104069471-104069493 CAGAGAAAACAGCTGAGGGAGGG - Intergenic
1122964708 14:105117161-105117183 CACAGAAGAGACCTGAGGGAGGG + Intergenic
1123785020 15:23662976-23662998 CCCAGTGGACAGATGAAGGAAGG + Intergenic
1124652912 15:31486077-31486099 CTCAGCAGACAACTGTGGGAAGG - Intronic
1125318082 15:38454043-38454065 CTGAGAGCACAGCTGAAGAAGGG - Intergenic
1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG + Intronic
1128125170 15:65186654-65186676 GTCAGAAAACAGCTGAAAGTAGG - Intergenic
1128951027 15:71882177-71882199 CTCGGAAGAAAGCTTAAGGCAGG - Intronic
1129813255 15:78528324-78528346 GACAGGAGACAGCGGAAGGATGG - Intronic
1130889832 15:88124337-88124359 CTCTGAGGACAGCTGAGGGGAGG + Intronic
1131498253 15:92934067-92934089 CTTAGAAGACATCTGGAAGAGGG - Intronic
1131643370 15:94315586-94315608 CTCACCATACACCTGAAGGAAGG + Exonic
1133872888 16:9705944-9705966 CACAGAGGACAGTTGATGGAAGG + Intergenic
1133904250 16:10006811-10006833 CACAGAAGAGAGTAGAAGGATGG - Intronic
1136475688 16:30511751-30511773 CTCAGAACACAGTAGCAGGAAGG + Intronic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1139373925 16:66485085-66485107 CCCAGAAGAGGGCGGAAGGAGGG + Intronic
1139978254 16:70832653-70832675 TTCAGATGAGAGCTGAAGAATGG + Intronic
1140198389 16:72874877-72874899 CTATGAAGACAGCAGAAGGTGGG - Intronic
1141252320 16:82369859-82369881 CTGAGATGACAGCTGAGCGATGG - Intergenic
1141252493 16:82370932-82370954 GTCAGAAGAAAACTGAAGAAAGG + Intergenic
1141755639 16:85988973-85988995 CTCAGGAGAGAGCTGGAGGAGGG - Intergenic
1141800070 16:86301431-86301453 ATCAGAAGACAGTTGACAGATGG - Intergenic
1141892172 16:86933614-86933636 ATCAGAAGACATCTGCAGGAAGG + Intergenic
1142009773 16:87707953-87707975 CACAGGAGAGAGCTGAAGGTGGG - Exonic
1142441867 16:90103673-90103695 CTCAGAAGACATCTGTGGGCAGG + Intergenic
1143680017 17:8469471-8469493 CTCAGTTGATAGCTGGAGGAAGG + Intronic
1144647250 17:16983567-16983589 CTCAGCAGAGAGCTGATGGTGGG - Intergenic
1144828157 17:18118106-18118128 CTCAGAAGGCAGGGCAAGGAGGG - Intronic
1146572920 17:33968362-33968384 CTCAGAACACAGTTGCAGGCGGG - Intronic
1147804255 17:43118731-43118753 TTCAGAAGAAAGCTAAAGGCCGG - Intronic
1149587538 17:57802616-57802638 CTCAGGAGAAATCTGTAGGATGG - Intergenic
1149777648 17:59370794-59370816 ATCAGCAAACAGCTTAAGGAAGG - Intronic
1151524932 17:74658570-74658592 AGCAGAAGGCAGCTGCAGGATGG + Intergenic
1151930867 17:77230574-77230596 CCCAGAAGACAGCAGCAGGCAGG + Intergenic
1151947955 17:77329733-77329755 CTGGGAAGAAACCTGAAGGATGG - Intronic
1152214007 17:79021826-79021848 CTAGAAAGACAGCTGAAGGCTGG - Intergenic
1152423013 17:80204216-80204238 CCCAGAAGATGGCTAAAGGAGGG - Exonic
1152795558 17:82304485-82304507 CTCAGAGGGCAGCTGGAAGAAGG - Intergenic
1154485458 18:14868343-14868365 CTCAGATGCCAGCAGAAGGAGGG - Intergenic
1155594571 18:27470151-27470173 TGCAGAAGCCTGCTGAAGGATGG - Intergenic
1156507104 18:37604292-37604314 CTCAGAGGACATCAGGAGGAAGG - Intergenic
1157588291 18:48819237-48819259 CTCAGAATGCAGCTCCAGGAGGG + Intronic
1158031287 18:52968146-52968168 CTCAGAGGGTAGCTGGAGGATGG - Intronic
1159505513 18:69330138-69330160 CTTAGCAGACATCTGAGGGAAGG - Intergenic
1159596618 18:70388658-70388680 CTCAGAAAACAGCAGAATAATGG - Intergenic
1159727144 18:71975405-71975427 TTCAGTTGACAGCTGAAGGTTGG + Intergenic
1162931211 19:13958817-13958839 CTCAGTAGACAGCTTAAGAAAGG + Intronic
1164821750 19:31256158-31256180 CTCATAGGACTGCTGCAGGATGG + Intergenic
1166542040 19:43611884-43611906 CTCAGAAGACATCTGCTGAATGG + Intronic
1166912008 19:46165576-46165598 CCTACATGACAGCTGAAGGAGGG + Intergenic
1167408134 19:49327755-49327777 TTCAGCAGAGAGCTGAAGGAAGG + Intergenic
1167594520 19:50419956-50419978 CTCACCAGACAGCTGAAGTGTGG - Exonic
1167745643 19:51350167-51350189 CTCAGCAGAGACCTCAAGGAGGG + Intronic
925147271 2:1589448-1589470 CTCAGAAGAGTCCTGCAGGAGGG + Intergenic
926073596 2:9922315-9922337 GTCAGAGGACAGCAGAGGGAAGG - Intronic
926718919 2:15944110-15944132 CCAAGAAGACAGCTGTTGGAAGG - Intronic
927382745 2:22498047-22498069 CTGAGAAGACTGTTGAAGGTTGG - Intergenic
928242893 2:29601934-29601956 CTCTGAGGACACCTGAAGGTGGG + Intronic
929356662 2:41033078-41033100 CTGAAAAGACAGCTTTAGGAGGG - Intergenic
929982728 2:46697108-46697130 GTAAGAAGAAAGCAGAAGGAAGG + Intergenic
930993334 2:57685942-57685964 CTAAGAAGACAGCTGCAGCTTGG - Intergenic
931172012 2:59813597-59813619 CACAGAAGACACCTTAAGAAAGG + Intergenic
931518607 2:63071143-63071165 CTGAGAAGACAGCCCAGGGAAGG - Intergenic
931648971 2:64451927-64451949 TTGAGAAGACCCCTGAAGGAGGG - Intergenic
933129020 2:78649766-78649788 TTCAGAAGAGAGGAGAAGGAAGG - Intergenic
933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG + Intronic
934689371 2:96346586-96346608 CTCGGAAGACAGGGGAATGAGGG + Intronic
935106131 2:100045231-100045253 CTCAGAAGACAACTGAGCTAGGG + Intronic
935335528 2:102012302-102012324 CTCTGAAGCCAGCTGGTGGAAGG - Intronic
935346334 2:102111790-102111812 CTCAGGAGACAGCTGCAAGTAGG + Intronic
935473132 2:103483614-103483636 TTGAGAAAACAGCTGAAAGAAGG - Intergenic
936283414 2:111162096-111162118 TGCAAAAGACAGCTGGAGGATGG - Intronic
937538527 2:122921181-122921203 CTCTGAAGACACTTGAGGGAAGG + Intergenic
938938551 2:136148661-136148683 CACAGAAGTGAGCTGAGGGAGGG - Intergenic
939982217 2:148795551-148795573 CTCCGAACACAGCTTCAGGACGG - Intergenic
940029003 2:149240794-149240816 CTGAGAACAAAGCTGTAGGAGGG - Intergenic
941452875 2:165680506-165680528 CTCTGGAGTCAGCTGAGGGAGGG - Exonic
944321360 2:198347493-198347515 TTCAGAGGCCAGCTGCAGGATGG - Intronic
944961446 2:204879244-204879266 CTCAGATGACAGGTCAAGCAGGG + Intronic
946044365 2:216809505-216809527 CTCAGGAGACAGGAGCAGGAGGG + Intergenic
947280503 2:228447584-228447606 CTCAGAGGACAACTGAAGTTAGG + Intergenic
947481759 2:230507137-230507159 CTCAGAAGACAGAAGCAGGAGGG + Intronic
948339483 2:237238009-237238031 ATCAGAAGGAAGCTGCAGGATGG + Intergenic
948786467 2:240355421-240355443 CTCAGAGGCCAGCTGCAGGGAGG + Intergenic
1168863216 20:1061128-1061150 CACAGAAGACAGCTGGAAGCAGG + Intergenic
1168981888 20:2011288-2011310 TTCAGGAGGCAGCTGAAGAAGGG + Intergenic
1169591322 20:7146315-7146337 CTTAGAAGACAGTTAAAGGACGG - Intergenic
1169648657 20:7842659-7842681 CTTAGAAGACAGAAGAAAGAGGG - Intergenic
1170738394 20:19030673-19030695 CCCAGAAGAAAGCAGAAAGAGGG - Intergenic
1171063276 20:21987395-21987417 ATCAGAAGAAAGCGGAATGAAGG - Intergenic
1173223099 20:41145507-41145529 CTCAGCAGGCAGCTCAAGTAGGG - Intronic
1173433452 20:43011894-43011916 CTCAGGAGAAAGATGAAGGCCGG - Intronic
1175010969 20:55735628-55735650 CTCAGGAGAAAGAGGAAGGATGG - Intergenic
1175297374 20:57918290-57918312 TTCAGAAGACACCTGAAGCTGGG + Intergenic
1175432467 20:58915657-58915679 CTAAAAAGACAGAAGAAGGAAGG - Intergenic
1176795878 21:13371134-13371156 CTCAGATGCCAGCAGAAGGAGGG + Intergenic
1177847055 21:26301879-26301901 CTCAGAAGACAGCAAAATGTGGG - Intergenic
1177848617 21:26320667-26320689 ATCAGAAGAGAGCTGAATAAAGG - Intergenic
1178174646 21:30082547-30082569 CTCAGAAAAAGGCTGAAGAAAGG - Intergenic
1179219339 21:39392548-39392570 CTCAGAAGAGACATGAAAGAGGG - Intronic
1179642905 21:42758912-42758934 CTCCGAGGACAGCAGAGGGAAGG + Intronic
1179979195 21:44887675-44887697 CTTTGAGGACAGGTGAAGGAAGG - Intronic
1180009771 21:45041587-45041609 CTCAGAAGACAGAAGAAGACGGG + Intergenic
1180289559 22:10784365-10784387 CTCAGATGCCAGCAGAAGGAGGG + Intergenic
1180305338 22:11068434-11068456 CTCAGATGCTAGCAGAAGGAGGG - Intergenic
1181467898 22:23120111-23120133 CTCACAAGGCAGCTGGAGGTGGG - Intronic
1181863821 22:25839966-25839988 CTGAGCAGAGAGCTGAAGGAGGG - Intronic
1182648738 22:31832982-31833004 CTGAGAAGAAAGCTGGAGGAAGG - Intronic
1183322376 22:37172927-37172949 CTCAGAGGATGGCTGGAGGATGG - Intronic
1183500846 22:38177918-38177940 TTCAGGAGAAAGCTGAAAGAAGG + Intronic
1184506559 22:44907266-44907288 ATCAGGAGGCATCTGAAGGATGG + Intronic
1185030593 22:48440985-48441007 GTGAGGAGACAGCTGCAGGATGG - Intergenic
949176615 3:1070962-1070984 CTCAGTGGACAGCTGATGAAGGG + Intergenic
950361289 3:12451137-12451159 ATCAGAAGTGAGCTGAGGGATGG + Intergenic
951686380 3:25349143-25349165 CTCAGAGGACAGGGGAAGGATGG + Intronic
952565191 3:34648534-34648556 GTCAGAAGGCATCTTAAGGATGG - Intergenic
952820261 3:37480440-37480462 CTGAGGAGAAAGCTGAAGGAAGG - Intronic
953097384 3:39792039-39792061 TTCAGAGGACACCTGAAGTAAGG - Intergenic
954433179 3:50482183-50482205 CTCAGAAAGCAGCTGAAGCAGGG + Intronic
954437733 3:50504801-50504823 CTCACAAGTCAGCCCAAGGAGGG + Intergenic
954580005 3:51698104-51698126 CTCAGCAGCCAGCTGAAGGGAGG - Intronic
954684510 3:52363107-52363129 CTCAGAAGACAGCTTGAAGGTGG - Exonic
954691331 3:52397146-52397168 ATGAAAAGACAGCTGATGGAGGG - Intronic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955215538 3:56982437-56982459 CTGAGAAGAGCCCTGAAGGAGGG - Intronic
955278643 3:57572727-57572749 CTGAAAAGAAAGCTGAATGAGGG - Intronic
955508067 3:59651828-59651850 CTCAGAAGCCAAGAGAAGGAAGG + Intergenic
956311067 3:67881164-67881186 CTCAGAAGACACATGAGGAAAGG - Intergenic
956674414 3:71721124-71721146 CTCCGAAGAGAGCTGAAGGCTGG + Intronic
957177670 3:76832597-76832619 CTGAGATGACCGCTGAAGGGTGG + Intronic
957580860 3:82071357-82071379 TCCAGAAGACAGCTGCTGGAAGG - Intergenic
957788994 3:84916540-84916562 CTCAGATCACAGTTGAAAGATGG - Intergenic
958503853 3:94947338-94947360 CACAGAAGAAAGATGAAGGCTGG + Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
960699697 3:120428042-120428064 CTCAGAAGACAGTGTAAGGGCGG - Intronic
961438797 3:126938350-126938372 CTGAGAAGACAGATGAAGAGCGG - Intronic
962320015 3:134382407-134382429 CTCAGAAGGCAGCAAAAGGTGGG - Intergenic
963996667 3:151717574-151717596 CTCAGAAGACAGGGAAATGAGGG - Intergenic
964716546 3:159728515-159728537 CTCATAAGACAGCTGATGCCAGG - Intronic
965679802 3:171238056-171238078 CACAGAAGACATCTGTTGGAGGG - Intronic
965679918 3:171239618-171239640 CACAGAAGACATCTGTTGGAGGG - Intronic
966793451 3:183693688-183693710 CTCAGAAGAGACCTGATGGGTGG - Intergenic
966971447 3:185049025-185049047 GACAGAAGAAAGCTGAAGGGAGG - Intronic
967374256 3:188783060-188783082 CTCAGAAGACAGGGGAAAAAGGG - Intronic
967527599 3:190513272-190513294 GGCAGAGGGCAGCTGAAGGAAGG + Intergenic
969443585 4:7231991-7232013 GTCAGAACACAGCTCCAGGATGG - Intronic
970749546 4:19341325-19341347 CTCAGAAGACAGTTGGAGATGGG - Intergenic
970873199 4:20840550-20840572 CTCAGTTGAGAGCAGAAGGATGG - Intronic
971006628 4:22381714-22381736 CTCAGAAGAAACAAGAAGGATGG + Intronic
971042692 4:22771915-22771937 CTCAGAAGGGAGATGAAGGTAGG - Intergenic
971699781 4:29956164-29956186 CAAGGAAAACAGCTGAAGGAGGG - Intergenic
972013155 4:34209498-34209520 CACAGAAGAAAGATGAAGGCTGG - Intergenic
972344047 4:38177804-38177826 CTCAGAACACAGCTGCGGCATGG + Intergenic
973022790 4:45224491-45224513 CTCAGAAGACAGGAAAATGAGGG + Intergenic
974800214 4:66807660-66807682 CTGACAAGACAGCAGAAGGAAGG + Intergenic
975715334 4:77200071-77200093 TTGAGAAGACAGTTGTAGGAAGG - Intronic
977996148 4:103499147-103499169 CTCTGGAGAAAGCTAAAGGAAGG - Intergenic
978948733 4:114529969-114529991 CTCAGAAGACAGGAAAATGAGGG + Intergenic
981285199 4:143009566-143009588 CTCAGAAGACAGGAGGATGAGGG - Intergenic
981852466 4:149246988-149247010 TTCAGCAGATAGCTGGAGGACGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
985099513 4:186444489-186444511 CTGAGTGGACAGCTGTAGGAGGG + Intronic
985622043 5:960861-960883 CTGAGAAGACAGCTGAAGCTTGG - Intergenic
985659297 5:1148095-1148117 CCCAGAAAACAGCTTCAGGAGGG - Intergenic
985701614 5:1376696-1376718 CTCACAAGTCACCTGAAGGCTGG - Intergenic
985736951 5:1588886-1588908 CACAGAAGATGGCTGCAGGATGG + Intergenic
985977352 5:3430612-3430634 CACAGAAGATGGCAGAAGGAAGG - Intergenic
986170777 5:5312759-5312781 CTCAGAAGAAAACAAAAGGAAGG - Intronic
987693377 5:21297248-21297270 CACAGGAGTCAGCTGAGGGAAGG - Intergenic
988345651 5:30035037-30035059 CTCAGAAGACAGAAGAAATATGG + Intergenic
989104849 5:37852409-37852431 CTCAGAAGGAAGCAGAAGAAGGG + Intergenic
989193628 5:38694786-38694808 CTCTGGAGACAGGTGAGGGAGGG + Intergenic
989229177 5:39066961-39066983 CTCAGAAGACAGGAAAATGAGGG - Intronic
989536756 5:42573107-42573129 CTCATCAGAATGCTGAAGGATGG - Intronic
989537769 5:42583239-42583261 GTCAGTAGAAAGCTGAAGCAAGG - Intronic
991278666 5:64883574-64883596 CTAAGAAGAAAGGAGAAGGAAGG + Intronic
992351225 5:75931162-75931184 CTCATAAGACAGGACAAGGAAGG - Intergenic
993752957 5:91692824-91692846 CTCAGAAGACAGGTAGATGAGGG - Intergenic
994285070 5:97955108-97955130 CTCAGAAGACAGGAGGATGAGGG + Intergenic
994431762 5:99674295-99674317 CTCAGAAGGAAGCAGAAGGCAGG - Intergenic
995347025 5:111133125-111133147 CTAGGAAGAAACCTGAAGGAAGG + Intergenic
996157215 5:120116240-120116262 CTCACAAGAAAAATGAAGGAGGG - Intergenic
996159595 5:120146143-120146165 CTCAGAAGACAGGAAAATGAGGG - Intergenic
996252302 5:121350480-121350502 TTCAAAAGTAAGCTGAAGGAAGG + Intergenic
996798436 5:127376387-127376409 CTGAGAAGACAGCTGGCAGATGG + Intronic
996927095 5:128840610-128840632 GTCAGAAGACAGGTGAATGCTGG + Intronic
997156626 5:131567315-131567337 CTCAAAAGCAAGCTCAAGGAAGG - Intronic
997247041 5:132358493-132358515 CAGAGAAGACAACTGCAGGAGGG - Intergenic
997631989 5:135375828-135375850 CTCAAAGGACTGCTGATGGAAGG - Intronic
998232080 5:140367239-140367261 CTTAAAAGACAGCAGATGGAAGG - Intronic
998307707 5:141095918-141095940 CTCCGGAGACAACGGAAGGATGG + Exonic
998587643 5:143444188-143444210 CTCATAAGATAGCTGGAGCAAGG + Intergenic
999606591 5:153323594-153323616 CTCTGAAGACAGCTGAAGATAGG - Intergenic
1000572142 5:162928116-162928138 CTCAGAAGCCAGCAGATGGAGGG - Intergenic
1001563719 5:172686413-172686435 CTGAGCATACAGCTGAGGGAAGG - Intronic
1001946259 5:175780770-175780792 CTCAGAACACAGAGAAAGGATGG - Intergenic
1002077299 5:176716371-176716393 ATCAGCAGACAGCTTAGGGACGG - Intergenic
1002112849 5:176931688-176931710 GTTAGAAGACAACTGAAGGCCGG + Intronic
1002381066 5:178830721-178830743 CTCAGATGCCAGCAGGAGGAGGG + Intergenic
1002724239 5:181283778-181283800 CTCAGACGCCAGCAGAAGGAGGG - Intergenic
1002905903 6:1449070-1449092 CAAAGGAGACAGCAGAAGGATGG - Intergenic
1003326386 6:5094624-5094646 CCAAGAAGACATCTGAAGGCTGG - Intergenic
1004073572 6:12324911-12324933 CTAAGAAGGCAGCAGAAGGCAGG - Intergenic
1004573397 6:16869704-16869726 CTTAGAAGGAATCTGAAGGAGGG + Intergenic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1004946885 6:20624979-20625001 CTCAGAAAACAGATGAAGAGAGG - Intronic
1005113843 6:22314869-22314891 CTCAGAAGACAGGAAAATGAGGG - Intergenic
1005392040 6:25343811-25343833 CACTTGAGACAGCTGAAGGAGGG - Intronic
1005953552 6:30647989-30648011 CTCAGGAGACAGTTAAAGGCTGG - Intronic
1006349948 6:33513625-33513647 CTCAGAAGGCAGCAGGTGGAGGG - Intergenic
1006419196 6:33922988-33923010 CTCAGTAGGCAGTTCAAGGAGGG - Intergenic
1006830289 6:36964184-36964206 GTCTGCAGCCAGCTGAAGGATGG - Intronic
1006929425 6:37678738-37678760 CTCAGAAGACAGCTGAAGGAAGG - Intronic
1007292341 6:40797217-40797239 CTCAGAAGCAAGCTGAAGGCTGG + Intergenic
1007676296 6:43598328-43598350 CTAAGAAGCAAGCTGAAGGCCGG + Intronic
1010148947 6:72707819-72707841 CTCAGAAGGCTGATGTAGGAGGG - Intronic
1010633019 6:78222134-78222156 CTCACATGACAGCTGAAATAAGG - Intergenic
1011129446 6:84038194-84038216 ATGAGCAGCCAGCTGAAGGAAGG + Intronic
1011149867 6:84259116-84259138 CACAGAGAACAGCTGAAAGAGGG - Intergenic
1011780850 6:90787777-90787799 CTCAGAAGCCAGCTGAATATTGG - Intergenic
1011866954 6:91841205-91841227 ATCAGAAAAAAGCTGAAGGCCGG - Intergenic
1013055871 6:106582423-106582445 CTAAGAATACAGCTGAAAGGTGG + Intronic
1014727264 6:124986461-124986483 GGCTGAAGACAGCTGGAGGAAGG - Intronic
1015097122 6:129429069-129429091 CAAAGAAGAGAGGTGAAGGATGG - Intronic
1015451372 6:133370933-133370955 CTCAGTACACATCTAAAGGAAGG - Intronic
1015769307 6:136752706-136752728 CTCAGAACCCAGCTAAAGGCTGG - Intronic
1016256242 6:142109113-142109135 CTATGAAAACAGCTGAAGCAGGG - Intergenic
1020155989 7:5725226-5725248 CTCAGCAGACACCTGTAGCACGG + Intronic
1020977030 7:15019141-15019163 TTCAAAAGAGAGCAGAAGGATGG + Intergenic
1021267515 7:18543377-18543399 CTCAGAAGACAGAAGCAGCAGGG - Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022962731 7:35445043-35445065 CTAAGAAGAACACTGAAGGAAGG + Intergenic
1024155197 7:46614946-46614968 CCCAGAAGACAGCTTCAGAAAGG - Intergenic
1024371112 7:48585001-48585023 CTCATATGAGAGATGAAGGAAGG - Intronic
1024386169 7:48754408-48754430 AGCAGAACACAGCAGAAGGAGGG + Intergenic
1024483402 7:49888956-49888978 CTCAGCAGACATATGGAGGATGG + Intronic
1024996068 7:55273949-55273971 CCCAGAAGAGAGCTACAGGACGG - Intergenic
1025017305 7:55449588-55449610 CCCTGAAGGCAGCTGAAGGTTGG + Intronic
1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG + Intronic
1026084054 7:67248388-67248410 CTCAGAAGAAAGCTTACGTAAGG + Intergenic
1026153653 7:67809242-67809264 CACAGAAGACAGCAGAGTGATGG + Intergenic
1026418234 7:70205288-70205310 CTCAGGAGACAGAGGCAGGAGGG - Intronic
1026692977 7:72565640-72565662 CTCAGAAGAAAGCTTACGTAAGG - Intronic
1027196609 7:76034915-76034937 CTCAGTAGACAGGTCAAGGTGGG - Intronic
1027650369 7:80859711-80859733 CTCAAAAGACAGCTAAATGGAGG - Intronic
1028035713 7:85979131-85979153 CTCAGAAGACAGAGGTGGGAGGG + Intergenic
1030445123 7:109639675-109639697 TTGAGAAGAAAACTGAAGGAAGG + Intergenic
1031631026 7:124042864-124042886 TTCCGAAGACAGGTGAAGGAAGG + Intergenic
1031973229 7:128078447-128078469 TTGAGAAGACAGCAGAAGCAAGG - Intronic
1031985776 7:128163865-128163887 CTCAGCAGACTGCTGATAGAAGG + Intergenic
1032282655 7:130517033-130517055 CACAGGTGACAGCTGAAAGAAGG + Intronic
1033157213 7:138967372-138967394 CTGAGCAGAGACCTGAAGGAAGG + Intronic
1033544446 7:142387268-142387290 CTCTGAGGATAGATGAAGGAAGG + Intergenic
1036090239 8:5657278-5657300 CAGAGAAGCCAGGTGAAGGAAGG - Intergenic
1036631566 8:10519451-10519473 CTGGGAAGACACCTGAAGGAAGG - Intergenic
1036732506 8:11278251-11278273 CTGAGAGGAGATCTGAAGGATGG + Intergenic
1037325063 8:17680820-17680842 CTGAGCAGACACATGAAGGAAGG + Intronic
1037604223 8:20423839-20423861 CATTGGAGACAGCTGAAGGAAGG + Intergenic
1037935718 8:22913758-22913780 GTCAAAATACAGCAGAAGGAGGG - Intronic
1038919253 8:32064479-32064501 CTACCAAGACAGCTGAAGGATGG - Intronic
1039823604 8:41155060-41155082 CTCACATGTCAGCTGGAGGATGG - Intergenic
1041212693 8:55569013-55569035 GTCAGAAGACCGCAGAAGAAAGG - Intergenic
1041724642 8:61006550-61006572 CTGAGCAGACAGATGAAGAAGGG + Intergenic
1042029428 8:64459651-64459673 CTCGGAAGACTGAGGAAGGAGGG - Intergenic
1042211953 8:66389847-66389869 GTCAGAAGAAAGATGAAGGCAGG - Intergenic
1042408861 8:68438894-68438916 CTCAAAAAAGAGCAGAAGGAAGG + Intronic
1042570960 8:70164234-70164256 CGCATAAGACAGTTGAAGCAAGG - Intronic
1043928206 8:86061580-86061602 CTTACATGACAGCTGAGGGAAGG - Intronic
1044729573 8:95219190-95219212 CTCAGGAGTCAGCTGCAGGAAGG + Intergenic
1045564851 8:103303375-103303397 CTCAGGAGAAAGGTGAAAGAAGG - Intronic
1045685766 8:104710012-104710034 CACTGAAAACAGCTGAAGGATGG - Intronic
1048418851 8:134257086-134257108 CTCAGAAGAGAGCAGCATGATGG - Intergenic
1048666543 8:136668156-136668178 CTCAGAAGACATCTGAAATATGG + Intergenic
1048991655 8:139764048-139764070 CTCAGAAGCCAAGTGAAGAAGGG + Intronic
1048999013 8:139813028-139813050 CTGAGAAGACAGCCTGAGGAAGG - Intronic
1049812735 8:144582741-144582763 CTCAGAAGTCCAATGAAGGAGGG + Intronic
1050728583 9:8681044-8681066 GTCAGGAGATAGGTGAAGGAAGG - Intronic
1050771470 9:9206663-9206685 CACAAAAGACAGATGAAGGCAGG - Intronic
1051225563 9:14895452-14895474 CTCAGAAGAAACAAGAAGGATGG + Intronic
1052886368 9:33652043-33652065 CTCACTAGACAGGGGAAGGAGGG - Intergenic
1055251689 9:74315307-74315329 CTCAGTTCACATCTGAAGGAAGG - Intergenic
1056238141 9:84616459-84616481 TTCAAAAGACAGCTGAAAGAAGG + Intergenic
1056584968 9:87921832-87921854 CTGAGTACACAGCTCAAGGAAGG - Intergenic
1057719534 9:97520824-97520846 CTATGAGGACTGCTGAAGGAGGG - Intronic
1058476754 9:105342508-105342530 CTGAGATGAAAGCTGAAGGAGGG - Intronic
1058810323 9:108632826-108632848 CTCAGAAAACAGCAGAAAGATGG + Intergenic
1059115006 9:111593506-111593528 CTCAGCAGACAACTCAGGGAGGG - Intronic
1059158590 9:112012329-112012351 CTCAGAAAACCTCTGAAGGGAGG + Intergenic
1059253542 9:112908589-112908611 CTCTTATGACAGCTGATGGAGGG + Intergenic
1059877765 9:118654952-118654974 CTCAGAAGAGATCTGAAAGATGG - Intergenic
1060594556 9:124840435-124840457 CCAAGGAGACAGCTGACGGATGG - Intergenic
1060682991 9:125582273-125582295 CTCACCAAACAGATGAAGGAAGG - Intronic
1061244907 9:129396547-129396569 ATGGGAGGACAGCTGAAGGATGG + Intergenic
1061723304 9:132567062-132567084 CCCAGAAGGGAGCTCAAGGAAGG - Intronic
1062730003 9:138103437-138103459 CTCAGAGGGCTGCTGGAGGATGG + Intronic
1185693981 X:2180021-2180043 CCAAGAAGAAAGCTGAAGGAAGG - Intergenic
1185914643 X:4022510-4022532 CTCAGAATACAGTTTAAGGCTGG - Intergenic
1186561153 X:10614710-10614732 ACCAGAAGACATCAGAAGGATGG + Intronic
1188626258 X:32288919-32288941 CTCAGAAGAAACAAGAAGGATGG + Intronic
1190043797 X:47095686-47095708 ATCAGAATAAAGCAGAAGGAAGG - Intergenic
1192615739 X:72620277-72620299 CTGTGAATACAACTGAAGGAGGG + Intronic
1192917073 X:75664201-75664223 CCTAGAAGACAGCAGATGGATGG + Intergenic
1194345642 X:92761275-92761297 CACAGAAGAAAGATGAAGGCTGG - Intergenic
1194973245 X:100367577-100367599 CTCACAAGACAGAAGATGGAAGG + Intronic
1195497444 X:105553310-105553332 CCCAGAAACCACCTGAAGGAGGG + Intronic
1198151040 X:133910090-133910112 CTCAGAGAAGAGATGAAGGATGG - Intronic
1199416140 X:147585214-147585236 CTTAGATGACTGCTGAAGAAGGG - Intergenic
1200653986 Y:5877926-5877948 CACAGAAGAAAGATGAAGGCTGG - Intergenic
1201908250 Y:19106801-19106823 ATGAAATGACAGCTGAAGGAAGG - Intergenic