ID: 1006929553

View in Genome Browser
Species Human (GRCh38)
Location 6:37679555-37679577
Sequence TCACAATATCGGGAGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006929553_1006929560 20 Left 1006929553 6:37679555-37679577 CCCTCTCTCTCCCGATATTGTGA No data
Right 1006929560 6:37679598-37679620 CTCCCATGCCGCCTCCCTGGTGG No data
1006929553_1006929558 17 Left 1006929553 6:37679555-37679577 CCCTCTCTCTCCCGATATTGTGA No data
Right 1006929558 6:37679595-37679617 AGCCTCCCATGCCGCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006929553 Original CRISPR TCACAATATCGGGAGAGAGA GGG (reversed) Intronic