ID: 1006929553 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:37679555-37679577 |
| Sequence | TCACAATATCGGGAGAGAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1006929553_1006929560 | 20 | Left | 1006929553 | 6:37679555-37679577 | CCCTCTCTCTCCCGATATTGTGA | No data | ||
| Right | 1006929560 | 6:37679598-37679620 | CTCCCATGCCGCCTCCCTGGTGG | No data | ||||
| 1006929553_1006929558 | 17 | Left | 1006929553 | 6:37679555-37679577 | CCCTCTCTCTCCCGATATTGTGA | No data | ||
| Right | 1006929558 | 6:37679595-37679617 | AGCCTCCCATGCCGCCTCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1006929553 | Original CRISPR | TCACAATATCGGGAGAGAGA GGG (reversed) | Intronic | ||