ID: 1006929555

View in Genome Browser
Species Human (GRCh38)
Location 6:37679565-37679587
Sequence CAGGCACGTGTCACAATATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8843
Summary {0: 1, 1: 0, 2: 41, 3: 821, 4: 7980}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006929555_1006929558 7 Left 1006929555 6:37679565-37679587 CCCGATATTGTGACACGTGCCTG 0: 1
1: 0
2: 41
3: 821
4: 7980
Right 1006929558 6:37679595-37679617 AGCCTCCCATGCCGCCTCCCTGG No data
1006929555_1006929560 10 Left 1006929555 6:37679565-37679587 CCCGATATTGTGACACGTGCCTG 0: 1
1: 0
2: 41
3: 821
4: 7980
Right 1006929560 6:37679598-37679620 CTCCCATGCCGCCTCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006929555 Original CRISPR CAGGCACGTGTCACAATATC GGG (reversed) Intronic