ID: 1006929557

View in Genome Browser
Species Human (GRCh38)
Location 6:37679584-37679606
Sequence GCATGGGAGGCTCTGTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006929557_1006929560 -9 Left 1006929557 6:37679584-37679606 CCTGTACACAGAGCCTCCCATGC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1006929560 6:37679598-37679620 CTCCCATGCCGCCTCCCTGGTGG No data
1006929557_1006929568 21 Left 1006929557 6:37679584-37679606 CCTGTACACAGAGCCTCCCATGC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1006929568 6:37679628-37679650 TGTGCCTCAGCCAGTGACAGCGG 0: 1
1: 0
2: 2
3: 29
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006929557 Original CRISPR GCATGGGAGGCTCTGTGTAC AGG (reversed) Intronic