ID: 1006929558

View in Genome Browser
Species Human (GRCh38)
Location 6:37679595-37679617
Sequence AGCCTCCCATGCCGCCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006929554_1006929558 16 Left 1006929554 6:37679556-37679578 CCTCTCTCTCCCGATATTGTGAC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1006929558 6:37679595-37679617 AGCCTCCCATGCCGCCTCCCTGG No data
1006929553_1006929558 17 Left 1006929553 6:37679555-37679577 CCCTCTCTCTCCCGATATTGTGA No data
Right 1006929558 6:37679595-37679617 AGCCTCCCATGCCGCCTCCCTGG No data
1006929556_1006929558 6 Left 1006929556 6:37679566-37679588 CCGATATTGTGACACGTGCCTGT No data
Right 1006929558 6:37679595-37679617 AGCCTCCCATGCCGCCTCCCTGG No data
1006929555_1006929558 7 Left 1006929555 6:37679565-37679587 CCCGATATTGTGACACGTGCCTG 0: 1
1: 0
2: 41
3: 821
4: 7980
Right 1006929558 6:37679595-37679617 AGCCTCCCATGCCGCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006929558 Original CRISPR AGCCTCCCATGCCGCCTCCC TGG Intronic