ID: 1006929560

View in Genome Browser
Species Human (GRCh38)
Location 6:37679598-37679620
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006929555_1006929560 10 Left 1006929555 6:37679565-37679587 CCCGATATTGTGACACGTGCCTG 0: 1
1: 0
2: 41
3: 821
4: 7980
Right 1006929560 6:37679598-37679620 CTCCCATGCCGCCTCCCTGGTGG No data
1006929553_1006929560 20 Left 1006929553 6:37679555-37679577 CCCTCTCTCTCCCGATATTGTGA 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1006929560 6:37679598-37679620 CTCCCATGCCGCCTCCCTGGTGG No data
1006929557_1006929560 -9 Left 1006929557 6:37679584-37679606 CCTGTACACAGAGCCTCCCATGC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1006929560 6:37679598-37679620 CTCCCATGCCGCCTCCCTGGTGG No data
1006929556_1006929560 9 Left 1006929556 6:37679566-37679588 CCGATATTGTGACACGTGCCTGT 0: 1
1: 0
2: 0
3: 37
4: 341
Right 1006929560 6:37679598-37679620 CTCCCATGCCGCCTCCCTGGTGG No data
1006929554_1006929560 19 Left 1006929554 6:37679556-37679578 CCTCTCTCTCCCGATATTGTGAC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1006929560 6:37679598-37679620 CTCCCATGCCGCCTCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr