ID: 1006929568

View in Genome Browser
Species Human (GRCh38)
Location 6:37679628-37679650
Sequence TGTGCCTCAGCCAGTGACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 258}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006929562_1006929568 4 Left 1006929562 6:37679601-37679623 CCATGCCGCCTCCCTGGTGGCAG 0: 1
1: 0
2: 0
3: 33
4: 319
Right 1006929568 6:37679628-37679650 TGTGCCTCAGCCAGTGACAGCGG 0: 1
1: 0
2: 2
3: 29
4: 258
1006929565_1006929568 -7 Left 1006929565 6:37679612-37679634 CCCTGGTGGCAGCCTCTGTGCCT No data
Right 1006929568 6:37679628-37679650 TGTGCCTCAGCCAGTGACAGCGG 0: 1
1: 0
2: 2
3: 29
4: 258
1006929557_1006929568 21 Left 1006929557 6:37679584-37679606 CCTGTACACAGAGCCTCCCATGC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1006929568 6:37679628-37679650 TGTGCCTCAGCCAGTGACAGCGG 0: 1
1: 0
2: 2
3: 29
4: 258
1006929566_1006929568 -8 Left 1006929566 6:37679613-37679635 CCTGGTGGCAGCCTCTGTGCCTC No data
Right 1006929568 6:37679628-37679650 TGTGCCTCAGCCAGTGACAGCGG 0: 1
1: 0
2: 2
3: 29
4: 258
1006929563_1006929568 -1 Left 1006929563 6:37679606-37679628 CCGCCTCCCTGGTGGCAGCCTCT No data
Right 1006929568 6:37679628-37679650 TGTGCCTCAGCCAGTGACAGCGG 0: 1
1: 0
2: 2
3: 29
4: 258
1006929561_1006929568 5 Left 1006929561 6:37679600-37679622 CCCATGCCGCCTCCCTGGTGGCA No data
Right 1006929568 6:37679628-37679650 TGTGCCTCAGCCAGTGACAGCGG 0: 1
1: 0
2: 2
3: 29
4: 258
1006929559_1006929568 8 Left 1006929559 6:37679597-37679619 CCTCCCATGCCGCCTCCCTGGTG No data
Right 1006929568 6:37679628-37679650 TGTGCCTCAGCCAGTGACAGCGG 0: 1
1: 0
2: 2
3: 29
4: 258
1006929564_1006929568 -4 Left 1006929564 6:37679609-37679631 CCTCCCTGGTGGCAGCCTCTGTG 0: 1
1: 0
2: 4
3: 33
4: 352
Right 1006929568 6:37679628-37679650 TGTGCCTCAGCCAGTGACAGCGG 0: 1
1: 0
2: 2
3: 29
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006929568 Original CRISPR TGTGCCTCAGCCAGTGACAG CGG Intronic