ID: 1006930414

View in Genome Browser
Species Human (GRCh38)
Location 6:37684492-37684514
Sequence GTCCTGGATTCCCCTAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006930414 Original CRISPR GTCCTGGATTCCCCTAAGCC TGG Intronic
900136316 1:1118587-1118609 GTGCAGGATTCCACTAGGCCAGG + Intergenic
900678761 1:3904476-3904498 TTCCTGGGTTCCCCAAAACCAGG + Intergenic
901858113 1:12057215-12057237 GGCCTGGATTCCTCTGGGCCTGG - Intergenic
902342333 1:15792164-15792186 GTCCTGGACTCCCTAAAGGCAGG + Intergenic
902955805 1:19923445-19923467 TCCCTGGATGCCCCTGAGCCTGG - Intronic
903345026 1:22678263-22678285 GTCCTGGATGCCACCACGCCTGG - Intergenic
905297339 1:36962525-36962547 GACCTGGAGACTCCTAAGCCAGG + Intronic
905675063 1:39819140-39819162 GTCCTGGAATCCCCCCAGCCAGG - Intergenic
905868409 1:41388887-41388909 ATCCTGGATTCCCACCAGCCTGG + Intergenic
915083674 1:153369715-153369737 GTCCTGGAATGGCCCAAGCCTGG - Intergenic
915325989 1:155081321-155081343 GTCGAGGAGTCCCCTAAGCCGGG + Intronic
916946236 1:169730581-169730603 GCCCTGGAATCCCCTGAGCATGG - Exonic
920531496 1:206705920-206705942 CTCCGGGAATTCCCTAAGCCTGG - Intronic
923500873 1:234562558-234562580 CTCCTGCTTTCCCCTAAGCCTGG - Intergenic
1063032543 10:2250153-2250175 TCCCTGGCTTCCCCTAACCCAGG + Intergenic
1070768147 10:79068163-79068185 CGCGTGGATTCCCCTAGGCCCGG - Intergenic
1076058714 10:127396308-127396330 GCCCTGGATCCCCCTATCCCAGG + Intronic
1076843273 10:133056968-133056990 GCCCTGGAGTCCCCGGAGCCTGG - Intergenic
1077390611 11:2299147-2299169 CTTCTGGATTACCCTAGGCCTGG - Intronic
1080407820 11:31995391-31995413 GGCTTGGCTTCCCCCAAGCCTGG + Intronic
1081855367 11:46300052-46300074 GAACTGGACTCCCCTACGCCAGG + Exonic
1083944581 11:65916952-65916974 GTCCTGGCATCCCCTCTGCCAGG + Exonic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1093389489 12:18601839-18601861 CCCCTGTATTTCCCTAAGCCCGG - Intronic
1095521298 12:43069723-43069745 TTCCTGAACTCCCCTAAGCCTGG + Intergenic
1095704730 12:45224179-45224201 GTCCTGGATTCCCCTAGGCAAGG - Intronic
1095772545 12:45977417-45977439 GTCATACATTCCCCTAACCCAGG - Intronic
1099081178 12:78183541-78183563 GTCCTGGATTCATCCAAGCCAGG - Intronic
1103542997 12:121679219-121679241 GTCCTGGCTTCCTCTGAGCCAGG - Intergenic
1103611285 12:122125808-122125830 GGCCTGTATTGCCCAAAGCCTGG + Intronic
1106452819 13:29898763-29898785 ATCCTGGGTTACCCTCAGCCTGG + Intergenic
1118943241 14:70358448-70358470 GTCTTGGCTTCCCCTAACACTGG + Intronic
1120995895 14:90418656-90418678 ATCCTGGATTGCACTAAGCCTGG - Intergenic
1121013612 14:90535423-90535445 GGCCTGGGTACCCCCAAGCCAGG - Exonic
1124347418 15:28931936-28931958 GTCCTGGATGCCCCTCTGCCAGG - Intronic
1124512126 15:30336451-30336473 GTCCTGGAATCCTCTCAGCCTGG + Intergenic
1124730788 15:32194300-32194322 GTCCTGGAATCCTCTCAGCCTGG - Intergenic
1125462749 15:39921365-39921387 GTCCCGGAATCCACTAAGCCTGG - Intergenic
1128132218 15:65236496-65236518 GGCCTGGTATCCCCTCAGCCTGG - Intronic
1128251655 15:66167983-66168005 CTCCTGCATTCTCCTAGGCCAGG + Intronic
1132584300 16:699671-699693 GTCCTGGAGTCACCTAAGACCGG - Intronic
1134214640 16:12307657-12307679 GTCTTGGATTTGCCGAAGCCTGG + Intronic
1139442898 16:66977618-66977640 GGCCTGGAATCCCCTCTGCCTGG - Intergenic
1141648459 16:85379711-85379733 GTCCCGGAGTCCCCTCAGCCTGG + Intergenic
1141699603 16:85636357-85636379 GTCCTGGAACGCCCTCAGCCAGG + Intronic
1141835014 16:86532687-86532709 GTGCTGACTTCCCTTAAGCCAGG - Intronic
1144478440 17:15609423-15609445 GCCCTGGATTCTCCCAACCCAGG + Intronic
1144919851 17:18754288-18754310 GCCCTGGATTCTCCCAACCCAGG - Intronic
1146954850 17:36931541-36931563 GTCCCGCAGTCCCCTAAGGCAGG - Intergenic
1147866941 17:43559451-43559473 GTCCTGATATTCCCTAAGCCCGG - Intronic
1150463857 17:65375253-65375275 ATCCTGGAAACCCCTAAGTCAGG + Intergenic
1157891492 18:51422393-51422415 CTCCTGGAGTCCTCTAATCCTGG + Intergenic
1161007411 19:1943539-1943561 ATACTGGCTTCCCCTAAGCTTGG - Intronic
1162180169 19:8863299-8863321 GTCCTGGATGTCCCTCAGCAGGG + Exonic
1162192667 19:8959404-8959426 GTCCTGGTGTCCCTTAATCCAGG + Exonic
1165138269 19:33684370-33684392 GTCCTGAAATCCCCAGAGCCGGG - Intronic
1166505395 19:43368392-43368414 CTTCTGCCTTCCCCTAAGCCAGG + Intergenic
1167055979 19:47112038-47112060 GTCCTGGCTGCCCCTGCGCCCGG - Intronic
1167350089 19:48969036-48969058 GCCCTGGAGTCCCCTGGGCCTGG - Exonic
1167921424 19:52786215-52786237 GTCTTCGCTTCCCCTGAGCCAGG - Intronic
1167944698 19:52978716-52978738 GTCCTGGATTCCCTTCAGGAAGG - Intergenic
1167960145 19:53098699-53098721 GTCCTGGATTCCCTTCAGGAAGG - Intronic
1167963934 19:53128507-53128529 GTCCTGGATTCCCTTCAGGAAGG - Intronic
1167988514 19:53338452-53338474 GTCCTGGATTCCCTTCAGGAAGG + Intronic
1168637800 19:58009894-58009916 GTCCTGGATTCGGCCAAGCCTGG - Exonic
925218346 2:2116761-2116783 GTCTTGGCTTCCTCCAAGCCTGG - Intronic
928358610 2:30644810-30644832 GTCCTGCATTCCCCTTTCCCAGG - Intergenic
930781455 2:55228067-55228089 GTCCTGGATTCCCTTAAAATTGG + Exonic
931719357 2:65056212-65056234 GTCCCGGCTTCCCATAGGCCAGG + Intergenic
942781395 2:179647619-179647641 CTCCTGGTTTCCCCTATCCCTGG - Intronic
946540611 2:220680500-220680522 GACCTATATTCACCTAAGCCTGG - Intergenic
1172615307 20:36279547-36279569 GTCCTGGATTCCCTACAGACAGG - Intergenic
1172647967 20:36483377-36483399 TTCCTGGTTTCCCCCCAGCCTGG - Intronic
1175471198 20:59229918-59229940 CTCCAGCATTCCCCAAAGCCAGG - Intronic
1179981614 21:44898916-44898938 GTCCTGGATCCCCCTAGGTGAGG - Intronic
1183037075 22:35148595-35148617 GTCGTGGCTTCTCCTAAGCAAGG + Intergenic
1183345157 22:37303427-37303449 CTCCTGGATTCCCCGGGGCCAGG - Intronic
1184333854 22:43841818-43841840 GTCCTGGAGTACCCACAGCCGGG - Exonic
1184511272 22:44934694-44934716 GTCCTGGAGTCCCCTGAGTCTGG + Intronic
949677684 3:6475763-6475785 TTCCTCCATTTCCCTAAGCCTGG + Intergenic
951551359 3:23878435-23878457 GTCCAGGGTTCCCCAAAGCCTGG + Intronic
953138795 3:40208484-40208506 TTCCTGGAGTTCCCCAAGCCTGG + Intronic
953610955 3:44446761-44446783 GTCCTGGAGTCCAGTGAGCCTGG + Exonic
965597514 3:170423081-170423103 GTGCTGAATTCCCCTAAGGCAGG + Intronic
966145509 3:176807412-176807434 GTTCTGCATTGCCCAAAGCCTGG - Intergenic
970560610 4:17278401-17278423 GTCCTGTGTTCCCCTAACCCTGG + Intergenic
974280578 4:59786396-59786418 GTTCTGGAGTCCCCTAATCTTGG + Intergenic
975117569 4:70696338-70696360 TTCCTGGACTCCCTGAAGCCAGG + Intergenic
977033301 4:91915992-91916014 ATCCTGGCTTCCCCCAAACCTGG - Intergenic
979866505 4:125761770-125761792 GTGGTGGATACCCCTAACCCTGG + Intergenic
980529227 4:134029378-134029400 CTACTGGAAACCCCTAAGCCTGG + Intergenic
995378791 5:111509539-111509561 TTCCTGGATTCCCCTGAACCTGG + Intronic
1002185613 5:177453559-177453581 GGCCTGGCTTCCCCCCAGCCTGG + Intronic
1002300053 5:178252780-178252802 CTCCTGGCCTCCCCCAAGCCTGG - Intronic
1006930414 6:37684492-37684514 GTCCTGGATTCCCCTAAGCCTGG + Intronic
1007743820 6:44029987-44030009 GTCCTGGATCCCCCAAGGCTGGG + Intergenic
1012862350 6:104574676-104574698 GCTCTGCATTCCCCTAAGCAAGG + Intergenic
1018194343 6:161341881-161341903 GGCCTGGAGTCCCATGAGCCAGG - Intergenic
1019881622 7:3866280-3866302 GTCCTAGAATTCCCTGAGCCTGG - Intronic
1020126965 7:5538462-5538484 GGCAGGGATTCCCCTTAGCCTGG - Intronic
1020451145 7:8321828-8321850 GTCCTCGATTCTTCCAAGCCTGG + Intergenic
1024052960 7:45640922-45640944 GTCCTGCATACCCCTAAGAGGGG + Intronic
1026927955 7:74206882-74206904 GTCCTGGACGCCTCTAGGCCTGG - Intronic
1030975809 7:116121776-116121798 GTCTGGGATTTGCCTAAGCCAGG + Intronic
1031942606 7:127805164-127805186 AACCAGGATTCCCCTAACCCAGG + Intronic
1032417403 7:131746923-131746945 AACCTGGATTCCCCCAAGGCAGG - Intergenic
1032845949 7:135752152-135752174 GTCCTGGATTCCCCATGGCCTGG - Intergenic
1037905922 8:22716023-22716045 ATCCTGGATGCACCTAGGCCAGG + Intronic
1040044835 8:42952121-42952143 GGCCTGGAGACCCCTGAGCCTGG - Intronic
1045365155 8:101469316-101469338 GTCATGCATTCCCCTCAACCTGG - Intergenic
1047447452 8:124932121-124932143 GTCCTGGAGTCTCCAAAGCATGG - Intergenic
1047748437 8:127862647-127862669 GTCCAGGATTGCCCGAGGCCAGG - Intergenic
1055677667 9:78681169-78681191 GCTCTGGATTCTCCTAAGCTTGG - Intergenic
1057318686 9:93991591-93991613 GTCCTGGATTCCCTTAACTGTGG + Intergenic
1057454568 9:95196646-95196668 ATCCAGGATTACCCTAATCCAGG + Intronic
1057882004 9:98799553-98799575 GTTCTGGAGGCCCCAAAGCCAGG + Intergenic
1059749365 9:117233292-117233314 TTCCTGGCTTCCACTGAGCCTGG - Intronic
1061131417 9:128710465-128710487 TTCCTCGATTCCCCAAGGCCAGG - Intronic
1061800060 9:133108898-133108920 GGCCTGGGCTCCCCTGAGCCAGG + Intronic
1062237092 9:135515523-135515545 GTCCTGTATTCAGATAAGCCAGG + Intergenic
1203506341 Un_KI270741v1:72847-72869 GTTCTGGAGTCCCATAAGCGGGG - Intergenic
1191877398 X:65810273-65810295 CTCCTGGACTCTCCAAAGCCTGG - Intergenic
1193944621 X:87719593-87719615 GTGCTGGAGTCACATAAGCCTGG + Intergenic
1197380811 X:125736659-125736681 GTCCTGGGGTCCCCTAAGCCAGG - Intergenic
1200869576 Y:8082967-8082989 GTCCTGGATTCTGCTAAGAGTGG - Intergenic
1200891008 Y:8324089-8324111 GTCCTGGATTCTGCCAAGACAGG + Intergenic