ID: 1006933099

View in Genome Browser
Species Human (GRCh38)
Location 6:37699051-37699073
Sequence CCGCCTCGAAGGGGCCCTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 69}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006933083_1006933099 22 Left 1006933083 6:37699006-37699028 CCCGAGCCCCGCTCCAGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 207
Right 1006933099 6:37699051-37699073 CCGCCTCGAAGGGGCCCTCGCGG 0: 1
1: 0
2: 1
3: 7
4: 69
1006933094_1006933099 -5 Left 1006933094 6:37699033-37699055 CCGGCACTCGGGTCTCAGCCGCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1006933099 6:37699051-37699073 CCGCCTCGAAGGGGCCCTCGCGG 0: 1
1: 0
2: 1
3: 7
4: 69
1006933089_1006933099 14 Left 1006933089 6:37699014-37699036 CCGCTCCAGCGGCGGGAGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1006933099 6:37699051-37699073 CCGCCTCGAAGGGGCCCTCGCGG 0: 1
1: 0
2: 1
3: 7
4: 69
1006933085_1006933099 21 Left 1006933085 6:37699007-37699029 CCGAGCCCCGCTCCAGCGGCGGG 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1006933099 6:37699051-37699073 CCGCCTCGAAGGGGCCCTCGCGG 0: 1
1: 0
2: 1
3: 7
4: 69
1006933088_1006933099 15 Left 1006933088 6:37699013-37699035 CCCGCTCCAGCGGCGGGAGTCCG 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1006933099 6:37699051-37699073 CCGCCTCGAAGGGGCCCTCGCGG 0: 1
1: 0
2: 1
3: 7
4: 69
1006933087_1006933099 16 Left 1006933087 6:37699012-37699034 CCCCGCTCCAGCGGCGGGAGTCC 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1006933099 6:37699051-37699073 CCGCCTCGAAGGGGCCCTCGCGG 0: 1
1: 0
2: 1
3: 7
4: 69
1006933091_1006933099 9 Left 1006933091 6:37699019-37699041 CCAGCGGCGGGAGTCCGGCACTC 0: 1
1: 0
2: 0
3: 0
4: 61
Right 1006933099 6:37699051-37699073 CCGCCTCGAAGGGGCCCTCGCGG 0: 1
1: 0
2: 1
3: 7
4: 69
1006933081_1006933099 27 Left 1006933081 6:37699001-37699023 CCGAACCCGAGCCCCGCTCCAGC 0: 1
1: 0
2: 4
3: 26
4: 281
Right 1006933099 6:37699051-37699073 CCGCCTCGAAGGGGCCCTCGCGG 0: 1
1: 0
2: 1
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006933099 Original CRISPR CCGCCTCGAAGGGGCCCTCG CGG Intronic
901008098 1:6181239-6181261 CTGCCTCGCAGGGGCACTGGGGG + Intergenic
901034602 1:6328845-6328867 GACCCTCGGAGGGGCCCTCGGGG + Intronic
901638229 1:10680201-10680223 CTGCCTGGAAGGGGCTCTCCTGG - Intronic
903628160 1:24745793-24745815 CCGCCTCCGAGGGCCCGTCGAGG + Intronic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
907884005 1:58576808-58576830 GCGCCTTGAAGCGGCCCTCGGGG + Exonic
914678640 1:149923555-149923577 GGGCCTCGAAGTGGGCCTCGAGG + Exonic
920266769 1:204729853-204729875 CCTCCTCGAAGGGACCCTATAGG + Intergenic
922572427 1:226642019-226642041 CCTCCTCGGTGGGGGCCTCGGGG + Exonic
1062898103 10:1120366-1120388 CCGCCTCCGAGGGGCACCCGGGG + Intronic
1063543866 10:6961409-6961431 CCACCTCCAAGAGGCCCTCTGGG - Intergenic
1072692541 10:97581345-97581367 CCACCTCTAAGTGGCCCCCGCGG - Exonic
1073417428 10:103396122-103396144 CCTCCGCGAAGCGTCCCTCGAGG - Intronic
1075386220 10:122057301-122057323 CCGGCTGGAAGGGGCACTAGGGG + Intronic
1076696070 10:132248008-132248030 CCGCCTGGAACGGGGGCTCGTGG - Intronic
1078452797 11:11452905-11452927 CTGCCTCGAATGGGCCCTCCTGG - Intronic
1090837308 11:130462732-130462754 CTGCCTCAAAGGGGCCTGCGTGG + Exonic
1092640650 12:10505604-10505626 CCGCCTCGCATGGGCCCAGGGGG + Intronic
1094849495 12:34376043-34376065 CCGCCTTGGGGTGGCCCTCGTGG + Intergenic
1094855955 12:34402910-34402932 CGGCCACGGAGGGGCCCACGGGG + Intergenic
1096817167 12:54208863-54208885 GAGCCTGGAAGGGGCCCTTGTGG - Intergenic
1098311944 12:69157218-69157240 CTGCCTCCAGGGGGCACTCGAGG - Intergenic
1103722134 12:122980761-122980783 CCGCCTCAAGGGGGCCCCCGGGG - Exonic
1105015830 12:132786416-132786438 CCGCCTGCAGGAGGCCCTCGCGG - Exonic
1118702809 14:68450562-68450584 CCACCTCTGAAGGGCCCTCGGGG + Intronic
1128709094 15:69858479-69858501 CAGGCTCGGAGGGGCTCTCGAGG - Intergenic
1130093518 15:80840032-80840054 CCTCCTCTAAGGGGCCCCCCAGG + Intronic
1137568743 16:49550932-49550954 CAGCCACAAAGGGGCCCTCTAGG - Intronic
1141866407 16:86752944-86752966 CCTTCTCGCTGGGGCCCTCGAGG - Intergenic
1148326363 17:46785619-46785641 CCTCCTCGGAAGGCCCCTCGTGG - Intronic
1150648129 17:66992593-66992615 ATGCCTCGAAGGGGCCCACATGG - Intronic
1152905797 17:82970265-82970287 CAGCCTCTCAGGGGGCCTCGGGG - Intronic
1160156934 18:76441621-76441643 CAGCCGCGCAGGGGCCCCCGCGG - Exonic
1160690923 19:460488-460510 CCGCCGCGAACGGGCTCCCGGGG + Intronic
1161477024 19:4491797-4491819 GCGCCACGGAGGGGCCCTCTGGG + Exonic
1162034689 19:7932592-7932614 CCGCCTGGGAGGGGTCCTGGGGG + Intronic
925262879 2:2543255-2543277 CCACCTCGGAGGGGCCGTGGGGG - Intergenic
925419988 2:3703865-3703887 GCGCCTCGAAGGTGGCCGCGCGG - Exonic
930177577 2:48315441-48315463 CCGCCTCGAGGGGGCCTCAGAGG + Intronic
938931175 2:136088143-136088165 CCGCCCCGCAGGAGCCCACGCGG + Intergenic
941164915 2:162074237-162074259 CCGCCCTCAGGGGGCCCTCGCGG - Exonic
948402105 2:237692012-237692034 CCGCCTCGGAGGGTCCCTCCCGG - Intronic
948402150 2:237692118-237692140 CCGCCTCGGAGGGGCCCTCCCGG - Intronic
948942479 2:241203326-241203348 GCGTCTTGAAGGGGCCCTGGGGG - Exonic
1169073699 20:2749359-2749381 CAGCCTGGCTGGGGCCCTCGGGG - Intronic
1170483783 20:16794519-16794541 CTGCCTCGAAGGGGTCCTTAGGG - Intergenic
1179656038 21:42845390-42845412 CCTTCCCGGAGGGGCCCTCGCGG + Intronic
1179882876 21:44300656-44300678 CCTCCTCCTCGGGGCCCTCGCGG + Intronic
1180125716 21:45788664-45788686 TCGTCTCTGAGGGGCCCTCGTGG - Intronic
1180182909 21:46125813-46125835 TGGCCTCAAAGGTGCCCTCGTGG - Exonic
1183994090 22:41620458-41620480 CCTCGTCGAAGGGGCTCTCGAGG + Intronic
1184517508 22:44971704-44971726 CCACCTCCAGGGAGCCCTCGTGG + Intronic
1185165647 22:49260776-49260798 CCGCCTCCAAAGGGTCCTCCTGG - Intergenic
1185420657 22:50732514-50732536 CTGCCTCCAAGGGGCCCTTGGGG - Intergenic
954822998 3:53347618-53347640 CCGCCTCTACGCGGGCCTCGCGG + Intergenic
955340709 3:58123110-58123132 CGGCCTCGAAGGTGGTCTCGTGG + Exonic
955703510 3:61705171-61705193 CCACCACGAAGGGGCTCTTGGGG + Intronic
968903982 4:3443402-3443424 CCGCCTCCAGGGGGCCCAGGTGG + Exonic
969712855 4:8854103-8854125 CTGCCTCGAATGGGTCCTGGAGG + Intronic
970394741 4:15654980-15655002 CCGCCTCGGACGTGCTCTCGGGG - Intronic
995764683 5:115602373-115602395 CGGCCTCGAGCGGCCCCTCGGGG - Exonic
1002333971 5:178465520-178465542 CAGCCTCGAGGAGGCCCTCCTGG + Intronic
1002925943 6:1605723-1605745 CCGCCTCGAAGGGCGTTTCGGGG - Intergenic
1003194899 6:3906030-3906052 CCGCCTCGACGGGGCCATCTGGG - Intergenic
1006933099 6:37699051-37699073 CCGCCTCGAAGGGGCCCTCGCGG + Intronic
1015904876 6:138107078-138107100 CCGCCTCCAGGAAGCCCTCGGGG - Intronic
1018580203 6:165301813-165301835 CCTCCTGGACGGGGCCCTCCTGG - Exonic
1019286586 7:226304-226326 CCGGCTAGGAGGGGCCCTGGAGG + Intronic
1022721096 7:32942652-32942674 CGGCCACGGAGGGGCCCTGGAGG - Intergenic
1032002186 7:128272397-128272419 CCCCTTCGACTGGGCCCTCGGGG - Intergenic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1041081399 8:54218294-54218316 CAGCCTCCCAGGGTCCCTCGAGG + Intergenic
1041166339 8:55096359-55096381 CCGCCTTGAAGGTGGCCTAGAGG - Intergenic
1060088447 9:120721933-120721955 CCGGCTTGAAGGGGCCATCACGG - Intergenic
1062623069 9:137431269-137431291 CTGCATCGAGGGGGCCCTGGTGG - Exonic
1062637335 9:137498491-137498513 CCGTGTCCAAGGGGCACTCGCGG - Intronic
1187904662 X:24054671-24054693 CCGCCTCGCACGGGCCGGCGGGG + Intergenic
1200235222 X:154464826-154464848 CCTCCTGGAAGGAGCACTCGTGG - Exonic