ID: 1006933112 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:37699098-37699120 |
| Sequence | GCCCCTCCCCGCGGGCGTTT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1006933112_1006933120 | 2 | Left | 1006933112 | 6:37699098-37699120 | CCCAAACGCCCGCGGGGAGGGGC | No data | ||
| Right | 1006933120 | 6:37699123-37699145 | AGGCTGGCAAGCGAGGCTGGTGG | 0: 1 1: 0 2: 0 3: 37 4: 307 |
||||
| 1006933112_1006933119 | -1 | Left | 1006933112 | 6:37699098-37699120 | CCCAAACGCCCGCGGGGAGGGGC | No data | ||
| Right | 1006933119 | 6:37699120-37699142 | CGTAGGCTGGCAAGCGAGGCTGG | 0: 1 1: 0 2: 1 3: 2 4: 91 |
||||
| 1006933112_1006933118 | -5 | Left | 1006933112 | 6:37699098-37699120 | CCCAAACGCCCGCGGGGAGGGGC | No data | ||
| Right | 1006933118 | 6:37699116-37699138 | GGGGCGTAGGCTGGCAAGCGAGG | 0: 1 1: 0 2: 0 3: 3 4: 89 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1006933112 | Original CRISPR | GCCCCTCCCCGCGGGCGTTT GGG (reversed) | Intronic | ||