ID: 1006933112

View in Genome Browser
Species Human (GRCh38)
Location 6:37699098-37699120
Sequence GCCCCTCCCCGCGGGCGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006933112_1006933120 2 Left 1006933112 6:37699098-37699120 CCCAAACGCCCGCGGGGAGGGGC No data
Right 1006933120 6:37699123-37699145 AGGCTGGCAAGCGAGGCTGGTGG 0: 1
1: 0
2: 0
3: 37
4: 307
1006933112_1006933119 -1 Left 1006933112 6:37699098-37699120 CCCAAACGCCCGCGGGGAGGGGC No data
Right 1006933119 6:37699120-37699142 CGTAGGCTGGCAAGCGAGGCTGG 0: 1
1: 0
2: 1
3: 2
4: 91
1006933112_1006933118 -5 Left 1006933112 6:37699098-37699120 CCCAAACGCCCGCGGGGAGGGGC No data
Right 1006933118 6:37699116-37699138 GGGGCGTAGGCTGGCAAGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006933112 Original CRISPR GCCCCTCCCCGCGGGCGTTT GGG (reversed) Intronic