ID: 1006934763

View in Genome Browser
Species Human (GRCh38)
Location 6:37709765-37709787
Sequence ACAGTGTAGGGCATGCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006934763_1006934776 30 Left 1006934763 6:37709765-37709787 CCAGAGGGCATGCCCTACACTGT No data
Right 1006934776 6:37709818-37709840 CAGCTCCCCACAGTGGTAACTGG No data
1006934763_1006934774 23 Left 1006934763 6:37709765-37709787 CCAGAGGGCATGCCCTACACTGT No data
Right 1006934774 6:37709811-37709833 CGAGCTCCAGCTCCCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006934763 Original CRISPR ACAGTGTAGGGCATGCCCTC TGG (reversed) Intergenic
No off target data available for this crispr