ID: 1006936554

View in Genome Browser
Species Human (GRCh38)
Location 6:37722858-37722880
Sequence CTAGTACTCCACATCCATGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006936550_1006936554 -1 Left 1006936550 6:37722836-37722858 CCTCGAGGCTGGTGCTGCCACCC No data
Right 1006936554 6:37722858-37722880 CTAGTACTCCACATCCATGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006936554 Original CRISPR CTAGTACTCCACATCCATGT CGG Intergenic
No off target data available for this crispr