ID: 1006937243

View in Genome Browser
Species Human (GRCh38)
Location 6:37727032-37727054
Sequence TGGGAGCATCGCTTAAGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006937238_1006937243 0 Left 1006937238 6:37727009-37727031 CCCAGCTACTCAGGAGGCTGAGA 0: 7228
1: 111845
2: 214076
3: 239146
4: 143572
Right 1006937243 6:37727032-37727054 TGGGAGCATCGCTTAAGCCCGGG No data
1006937239_1006937243 -1 Left 1006937239 6:37727010-37727032 CCAGCTACTCAGGAGGCTGAGAT 0: 1467
1: 21495
2: 128000
3: 228119
4: 235363
Right 1006937243 6:37727032-37727054 TGGGAGCATCGCTTAAGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006937243 Original CRISPR TGGGAGCATCGCTTAAGCCC GGG Intergenic
No off target data available for this crispr