ID: 1006937814

View in Genome Browser
Species Human (GRCh38)
Location 6:37730555-37730577
Sequence CGTCCTCCCCACAAATGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006937814_1006937821 4 Left 1006937814 6:37730555-37730577 CCTCCGCATTTGTGGGGAGGACG No data
Right 1006937821 6:37730582-37730604 AAAAGAGACATTTGGCGGGAGGG No data
1006937814_1006937817 -4 Left 1006937814 6:37730555-37730577 CCTCCGCATTTGTGGGGAGGACG No data
Right 1006937817 6:37730574-37730596 GACGGAGCAAAAGAGACATTTGG No data
1006937814_1006937824 24 Left 1006937814 6:37730555-37730577 CCTCCGCATTTGTGGGGAGGACG No data
Right 1006937824 6:37730602-37730624 GGGCAGAGCAAAAGAGAGGAGGG No data
1006937814_1006937819 0 Left 1006937814 6:37730555-37730577 CCTCCGCATTTGTGGGGAGGACG No data
Right 1006937819 6:37730578-37730600 GAGCAAAAGAGACATTTGGCGGG No data
1006937814_1006937820 3 Left 1006937814 6:37730555-37730577 CCTCCGCATTTGTGGGGAGGACG No data
Right 1006937820 6:37730581-37730603 CAAAAGAGACATTTGGCGGGAGG No data
1006937814_1006937822 20 Left 1006937814 6:37730555-37730577 CCTCCGCATTTGTGGGGAGGACG No data
Right 1006937822 6:37730598-37730620 GGGAGGGCAGAGCAAAAGAGAGG No data
1006937814_1006937823 23 Left 1006937814 6:37730555-37730577 CCTCCGCATTTGTGGGGAGGACG No data
Right 1006937823 6:37730601-37730623 AGGGCAGAGCAAAAGAGAGGAGG No data
1006937814_1006937818 -1 Left 1006937814 6:37730555-37730577 CCTCCGCATTTGTGGGGAGGACG No data
Right 1006937818 6:37730577-37730599 GGAGCAAAAGAGACATTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006937814 Original CRISPR CGTCCTCCCCACAAATGCGG AGG (reversed) Intergenic
No off target data available for this crispr