ID: 1006938453

View in Genome Browser
Species Human (GRCh38)
Location 6:37735047-37735069
Sequence ATCCCTGTTCTCTAATATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006938453_1006938454 2 Left 1006938453 6:37735047-37735069 CCTCTATATTAGAGAACAGGGAT No data
Right 1006938454 6:37735072-37735094 CTCCAATTTAGAACAAGACAAGG No data
1006938453_1006938456 17 Left 1006938453 6:37735047-37735069 CCTCTATATTAGAGAACAGGGAT No data
Right 1006938456 6:37735087-37735109 AGACAAGGTCCCTGCTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006938453 Original CRISPR ATCCCTGTTCTCTAATATAG AGG (reversed) Intergenic
No off target data available for this crispr