ID: 1006938456

View in Genome Browser
Species Human (GRCh38)
Location 6:37735087-37735109
Sequence AGACAAGGTCCCTGCTCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006938455_1006938456 -10 Left 1006938455 6:37735074-37735096 CCAATTTAGAACAAGACAAGGTC No data
Right 1006938456 6:37735087-37735109 AGACAAGGTCCCTGCTCTTAAGG No data
1006938453_1006938456 17 Left 1006938453 6:37735047-37735069 CCTCTATATTAGAGAACAGGGAT No data
Right 1006938456 6:37735087-37735109 AGACAAGGTCCCTGCTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006938456 Original CRISPR AGACAAGGTCCCTGCTCTTA AGG Intergenic
No off target data available for this crispr