ID: 1006939462

View in Genome Browser
Species Human (GRCh38)
Location 6:37742413-37742435
Sequence TGGTTGTGAACAGAGGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006939459_1006939462 2 Left 1006939459 6:37742388-37742410 CCTGGGAAAGGTGAAGGAGGCAA No data
Right 1006939462 6:37742413-37742435 TGGTTGTGAACAGAGGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006939462 Original CRISPR TGGTTGTGAACAGAGGACAG AGG Intergenic