ID: 1006941575

View in Genome Browser
Species Human (GRCh38)
Location 6:37755129-37755151
Sequence GTGGGGTTGTTTTCCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006941571_1006941575 -3 Left 1006941571 6:37755109-37755131 CCTGGGTAGAGTGGAAGGCAGTG No data
Right 1006941575 6:37755129-37755151 GTGGGGTTGTTTTCCTCTCCTGG No data
1006941566_1006941575 12 Left 1006941566 6:37755094-37755116 CCCAGAAGATTCCTGCCTGGGTA No data
Right 1006941575 6:37755129-37755151 GTGGGGTTGTTTTCCTCTCCTGG No data
1006941567_1006941575 11 Left 1006941567 6:37755095-37755117 CCAGAAGATTCCTGCCTGGGTAG No data
Right 1006941575 6:37755129-37755151 GTGGGGTTGTTTTCCTCTCCTGG No data
1006941570_1006941575 1 Left 1006941570 6:37755105-37755127 CCTGCCTGGGTAGAGTGGAAGGC No data
Right 1006941575 6:37755129-37755151 GTGGGGTTGTTTTCCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006941575 Original CRISPR GTGGGGTTGTTTTCCTCTCC TGG Intergenic
No off target data available for this crispr